Наличие среди курящих всего 5 носите-лей комплекса гомозигот дикого типа по четы-рем локусам не позволяло проанализировать их распределение по возрасту.


Чтобы посмотреть этот PDF файл с форматированием и разметкой, скачайте его и откройте на своем компьютере.
Государственное научное учреждение
«ИНСТИТУТ ГЕНЕТИКИ И ЦИТОЛОГИИ
НАЦИОНАЛЬНОЙ АКАДЕМИИ НАУК БЕЛАРУСИ»
МОЛЕКУЛЯРНАЯ И ПРИКЛАДНАЯ ГЕНЕТИКА 
СБОРНИК НАУЧНЫХ ТРУДОВ
Издается с 2005 года
Выходит два раза в год
УДК [577.21 + 575] (082)
Молекулярная и прикладная генетика
: сб. науч. тр. / Институт генетики и
цитологии 
НАН Беларуси; редколл.: А.В. Кильчевский (гл. ред.) [и др.].
– Минск: Институт генетики и 
цитологии НАН Беларуси, 2016.
– Т. 20. – 112 с. – ISSN 1999-9127.
В сборнике научных трудов публикуются обзорные и экспериментальные статьи в области молекулярной и 
прикладной генетики растений, микроорганизмов, животных, человека, отражающие исследования генетических 
процессов на молекулярном, клеточном, организменном и популяционном уровнях. Особое внимание уделяет
ся наиболее актуальным проблемам геномики, генетической и клеточной инженерии. Публикуются результаты 
изучения генетических основ селекции растений, животных и микроорганизмов, разработки эффективных био
технологий для сельского хозяйства, здравоохранения, охраны окружающей среды, биобезопасности.
Сборник предназначен для специалистов, работающих в области генетики, преподавателей, аспирантов и сту
дентов ВУЗов биологического, сельскохозяйственного и медицинского профиля.
Редакционная коллегия:
А.В. Кильчевский
– главный редактор, Л.В. Хотылева 
– зам. главного редактора; 
К.У. Вильчук, С.И. Гриб, О.Г. Давыденко, А.Н. Евтушенков, А.П.
Ермишин, 
А.И. Ковалевич, Ф.И. Привалов, А.В. Сукало, В.А. Лемеш, С.А. Лихачев, 
Максимова, С.Б. Мельнов, М.Е. Михайлова, И.Б. Моссэ, М.Е. Никифоров, 
В.Е. Падутов, В.Н. Решетников, Е.А. Сычева, Н.И.
Дубовец, В.В. Титок, И.П. Шейко, 
О.Н. Харкевич – члены редколлегии; 
И.В. Широкая
– ответственный секретарь.
        
УДК [577.21 + 575] (082)

Институт генетики 
цитологии НАН Беларуси, 2016
Молекулярная и прикладная генетика. Том 20, 2016
г.
ОДЕР
О.Ю. Баранов, Д.И. Каган, В.Е. Падутов
Оценка влияния различных факторов на формирование генетической структуры и уровень 
генетической изменчивости популяций лесных древесных видов
..............................................
С.И. Вакула, Н.В. Анисимова, В.В. Титок, В.Н. Леонтьев, Л.В. Хотылева, А.В.
Кильчевский
Многомерный статистический анализ генетической изменчивости льна масличного
О.В. Дубровная, И.И. Лялько, А.В. Бавол, С.С. Воронова, А.Н. Гончарук
Анализ мейоза у трансгенных растений пшеницы, полученных методом 
Agrobacterium
опосредованной трансформации в культуре 
vitro
.................................................
21
О.П. Шатарнов, Т.М. Шатарнова, Т.А. Силкова, Н.С. Фомченко, О.Г. Давыденко
Влияние комбинационной способности родительских линий на показатели продуктивности 
гибридов подсолнечника (
Helianthus annuus
 L.)
.....................................................................................
30
О.А. Межнина, О.Ю. Урбанович
Идентификация сортов земляники садовой (
) с использованием 
SSR-маркеров
...............................................................................................................................................
37
Н.В. Савина, Н.В. Никитченко, Т.Д. Кужир, Р.И. Гончарова
Полиморфизм генов, кодирующих ДНК-геликазы: влияние на продолжительность жизни
...
46
Е.А. Аксенова, Н.А. Мартусевич, О.В. Cергейчик, Н.П. Митьковская
Частота HLA-DRB1 аллелей и генотипов у пациентов с АЦЦП-позитивным вариантом 
ревматоидного артрита и их родственников 1-й и 2-й степеней родства
Н.Н. Чакова, С.С. Ниязова, С.М. Комиссарова
Взаимодействие аллельных вариантов генов симпатоадреналовой и ренин-ангиотензин-
альдостероновой систем при гипертрофической кардиомиопатии
............................................
61
Н.В. Савина, Н.В. Никитченко, Т.Д. Кужир, С.Л. Поляков, А.И. Ролевич, С.А. Красный, 
Р.И. Гончарова
Полиморфизм генов эксцизионной репарации ДНК: влияние на рецидивирование рака 
мочевого пузыря у белорусских пациентов
О.Д. Левданский, М.С. Родькин, Д.Е. Данилов, В.С. Панкратов, А.
Около-Кулак, А.В. Троян, 
И.А. Карпов, О.Г. Давыденко
Полиморфизм генов 
-α среди коренного населения Беларуси, а также у 
пациентов с хроническим гепатитом С
Н.Г. Седляр, А.Л. Гончар, М.Д. Амельянович, И.Б. Моссэ
Роль генетических факторов в предрасположенности к невынашиванию беременности
......
87
Л.В. Кухтинская, А.В. Зураев, В.А. Будевич, И.Б. Моссэ
Современные представления о генетических детерминантах психоэмоциональной 
устойчивости человека (обзорная статья)
Правила оформления статьи
110
Molecular and Applied Genetics. Vol. 20, 2016
O.Yu. Baranov, D.I. Kagan, V.E. Padutov
Evaluation the Various Factors In�uence on Genetic Structure and Variability of Forest Tree 
S.I. Vakula, N.V. Anisimova, V.V. Titok, V.N. Leontiev, L.V. Khotyleva, A.V.
Multivariate Statistical Analysis of the Flaxseed Genetic Variability
O.V. Dubrovna, I.I. Lyalko, A.V. Bavol, S.S. Voronova, A.N. Goncharuk
The Analysis of Meiosis in Transgenic Wheat Plants Obtained by 
Agrobacterium
Transformation 
In Vitro
O.P. Shatarnov, T.M. Shatarnova, T.A. Silkova, N.S. Fomchenko, O.G. Davydenko
Effect of Combining Ability of Parental Lines on Productivity Indicators of Sun�ower Hybrids 
O.A. Mezhnina, O.Yu. Urbanovich 
N.V. Savina, N.V. Nikitchenko, T.D. Kuzhir, R.I. Goncharova
Polymorphism of Genes Coding DNA Helicases: Impact on the Life Span
E.A. Aksyonova, N.A. Martusevich, O.V. Sergeichik, N.P. Mitkovskaya
The Frequency of HLA-DRB1 Alleles and Genotypes in Patients with ACCP Antibody-Positive 
Rheumatoid Arthritis and Their Nearest Relatives
N.N. Chakova, S.S. Niyazova, S.M. Komissarova
Intergenic Interaction of Sympathoadrenal and Renin-Angiotensin-Aldosterone Systems Genes 
N.V. Savina, N.V. Nikitcheko, T.D. Kuzhir, S.L. Polyakov, A.I. Rolevich, S.A. Krasny, 
R.I. Goncharova
A.D. Liaudanski, M.S. Rodzkin, D.E. Danilau, V.S. Pankratov, A. Okolo-Kulak, N.V. Trayan, 
I.A. Karpov, O.G. Davydenko
N.G. Sedlyar, A.L. Gonchar, M.D. Ameliyanovich, I.B. Mosse
L.V. Kukhtsinskaya, A.V. Zuraev, V.A. Budevich, I.B. Mosse
(Review Article)
110
Молекулярная и прикладная генетика. Том 20, 2016
г.
УДК 630*165.3
О.Ю. Баранов, Д.И. Каган, В.Е. Падутов
ОЦЕНКА ВЛИЯНИЯ РАЗЛИЧНЫХ ФАКТОРОВ НА ФОРМИРОВАНИЕ 
ГЕНЕТИЧЕСКОЙ СТРУКТУРЫ И УРОВЕНЬ ГЕНЕТИЧЕСКОЙ 
ИЗМЕНЧИВОСТИ ПОПУЛЯЦИЙ ЛЕСНЫХ ДРЕВЕСНЫХ ВИДОВ
Институт леса НАН Беларуси
246001, Республика Беларусь, г. Гомель ул. Пролетарская 71; e-mail: [email protected]
В статье, на примере основных лесных древесных видов Беларуси, рассмотрено влияние различных факто
ров (размер и структура ареала; наличие географических и репродуктивных барьеров, препятствующих обме
ну генетическим материалом между насаждениями; интрогрессивная гибридизация; наличие антропогенных 
и биотических факторов, приводящих к резкому колебанию эффективной численности популяций; особен
ности размножения и организации генома) на формирование генетической структуры и уровня генетической 
изменчивости популяций.
Ключевые слова:
 популяционно-генетическая структура, генетическая изменчивость, ДНК-маркеры.
Введение
антропогенные и биотические факторы, при
водящие к резкому колебанию эффективной 
численности популяций; особенности размно
жения и организации генома [2].
В ходе исследований нами было проведе
но изучение влияния различных факторов и 
биологических особенностей на формирова
ние популяционно-генетической структуры 
и значение основных параметров, характери
зующих уровень генетической изменчивости 
лесных древесных растений.
Генетические процессы, протекающие в 
популяциях различных живых организмов, 
обусловлены биологическими характеристи
ками видов, включая взаимодействие отдель
ных индивидов и их сообществ с фактора
ми внешней среды, и являются основой для 
формирования адаптационного потенциала, 
определяя направленность микроэволюцион
ных изменений.
Среди основных специфических характе
ристик лесных древесных видов растений 
следует отметить: длительность жизненного 
цикла, доминирующую роль в биоценозах, 
эволюционные и исторические аспекты, свя
занные с генезисом и миграционными про
цессами популяций, наличие древостоев как 
естественного, так и искусственного проис
хождения, превалирование панмиксии в по
пуляциях, доминирование абиотических фак
торов в формировании и функционировании 
фитоценозов и др. [1]. Среди потенциальных 
факторов, способных прямым или косвенным 
образом оказывать
влияние на популяционно-
генетическую структуру лесных древесных 
видов, можно выделить следующие: размер, 
форма и внутренняя структура ареала; нали
чие географических, физиологических и про
чих барьеров, препятствующих обмену гене
тическим материалом между насаждениями; 
интрогрессивная гибридизация; негативные 
Материалы и методы
Материал для популяционно-генетических 
исследований был собран в естественных и 
искусственных насаждениях основных дре
весных пород Беларуси на протяжении 2001–
2015
гг. В ходе работы были использованы раз
личные методы ДНК-маркирования, согласно 
[3]. Для оценки основных параметров, опи
сывающих генетическую структуру, уровень 
изменчивости, степень подразделенности и 
дифференциации генетического полиморфиз
ма, использован ряд статистических показате
лей, описанных ранее [4].
Результаты и обсуждение
В качестве модельных видов для изучения 
влияния структуры ареала были выбраны бе
реза повислая (
Betula pendula
) и береза карли
ковая (
Betula nana
). Повислоберезовые леса 
Молекулярная и прикладная генетика. Том 20, 2016
г.
 Оценка влияния различных факторов на формирование генетической структуры... 
широко распространены на территории Бе
ларуси и составляют 11,9% от лесопокрытой 
площади страны. При этом представленность 
повислоберезовых фитоценозов в различных 
частях Беларуси является однородной, в том 
числе и в разрезе геоботанических подзон [5]. 
то
же время ареал березы карликовой на 
территории Беларуси представлен редкими 
островными насаждениями, произрастающи
ми преимущественно на сфагновых боло
тах 
в северной части страны. При этом следует 
отметить, что береза карликовая является в 
Беларуси эндемиком, реликтом ледниковой 
эпохи, и происхождение островных популяций 
 в основном связано не с их формиро
ванием из ограниченного числа родительских 
растений, а с сокращением и фрагментацией 
ранее сплошного ареала березы карликовой 
на территории страны в постледниковый пе
риод [6].
Анализ уровня генетической дифференциа
ции среди популяций показал, что значение 
коэффициента D
 для белорусских насажде
ний березы повислой варьировало от 0,005 
до 0,019 (RAPD-анализ), составляя в среднем 
0,009. В то же время для 
B. nana
 показатель 
 был выше (0,01–0,025 (0,014)), что ука
зывает на бóльшую индивидуальность гене
тической структуры островных популяций и 
относительно низкую интенсивность генного 
потока между ними. Величина коэффициента 
подразделенности G
ST
 между насаждениями 
березы повислой (0,045) была ниже анало
гичного показателя, вычисленного для бе
резы карликовой (0,067), что в свою очередь 
тоже указывает на более высокий уровень 
межпопуляционных различий, выявляемых 
у 
B. nana
. Полученные данные об уровне 
подразделенности и дифференциации, по 
всей видимости, связаны с превалированием 
генетико-автоматических процессов в попу
ляциях с низкой эффективной численностью 
B. nana
), что в сочетании с факторами изо
ляции (географическим барьером) приводит 
к усилению межпопуляционной генетической 
разнородности [7].
Одновременно с этим, некоторые древостои 
видов со сплошным ареалом также могут ха
рактеризоваться значительной степенью меж
популяционной дифференциации. Наличие 
высокого уровня генотипических различий 
между насаждениями данных видов в ряде 
случаев может быть связано с периодическим 
колебаниями численности индивидов и «эф
фектом основателя», имевших место в ходе 
исторического генезиса популяций. 
Так, в ходе SSRP-анализа шести географи
чески удаленных искусственных древостоев 
сосны обыкновенной (
Pinus sylvestris
), пред
ставляющих собой полусибсовое потомство 
от двух плюсовых деревьев (№
выращиваемых в трех различных опытных 
объектах, были определены параметры, ха
рактеризующие популяционно-генетическую 
структуру. Несмотря на умеренные различия 
уровня генетической изменчивости (<10% от 
величины параметров), группы древостоев, 
принадлежащие к разным семьям, характе
ризовались специфическими особенностями 
генетической структуры. Так, уровень гене
тической дифференциации D
 между семья
ми составил 0,2, что в 8–10 раз превышало 
аналогичный показатель, рассчитанный для 
географически изолированных выборок, но 
относящихся к тому или иному полусибсово
му потомству – 0,02–0,025 [8].
Аналогичные процессы, связанные с «эф
фектом основателя», а также превалирующим 
участием определенных генотипов для воспро
изводства структуры популяции, могут наблю
даться при анализе насаждений, произрастаю
щих в различных типах экологических условий. 
В качестве модельных объектов были вы
браны популяции сосны обыкновенной 
P.
sylvestris
), произрастающих в альтерна
тивных условиях гидрологического режима, 
в частности – суходольных и болотных на
саждений. Проведенное изучение параметра 
подразделенности G
ST
 среди изученных вы
борок показало значительное варьирование 
значений среди используемых RAPD-локусов 
[9]. Исходя из полученных результатов, для 
дальнейшего анализа межпопуляционных 
различий были выбраны локусы, характери
зующиеся высоким уровнем показателя G
ST
 – 
Oligo 6-1, Oligo 6-3, Oligo 9-1, Oligo 8-2, Oligo 
26-1, Oligo 6-2 [9]. Сравнение коэффициентов 
генетической дистанции Неи, рассчитанных 
на основании изучения частот встречаемо
сти аллельных вариантов для каждого из вы
бранных локусов по отдельности, для боль
шинства маркеров (Oligo 6-1, Oligo 6-3, Oligo 
Молекулярная и прикладная генетика. Том 20, 2016
г.
 Оценка влияния различных факторов на формирование генетической структуры... 
9-1, Oligo 8-2 и Oligo 6-2) не выявило суще
ственных различий между болотными и сухо
дольными насаждениями (D
   0,032) [7, 9]. 
то
же
время при анализе уровня генетиче
ской дифференциации по локусу Oligo 26-1,
было установлено наличие существенных 
отличий между популяциями, различающих
ся условиями произрастания. Так, величина 
 между экотипами в 15–18 раз превышала 
аналогичный показатель, выявленный среди 
насаждений со сходным типом гидрологиче
ского режима. 
Таким образом, проведенное изучение 
генетических структур суходольных и бо
лотных насаждений в целом не выявило су
щественных изменений в геноме деревьев 
сосны обыкновенной из различных условий 
местопроизрастания. Тем не менее, по ряду 
маркеров были выявлены достоверные раз
личия между данными типами насаждений, 
что по всей видимости указывает на наличие 
ограниченного числа генов, детерминирую
щих приспособленность к условиям гидроло
гического режима. Уровень выявленных раз
личий по диагностическим RAPD-маркерам 
не являлся абсолютным, что указывает на от
сутствие прямой взаимосвязи между конкрет
ными данными локусами и приспособленно
стью к типу условий произрастания (степени 
увлажненности). По всей видимости, данные 
локусы следует рассматривать как генетиче
ские маркеры, находящиеся в группе сцепле
ния с генами, отвечающими за приспособле
ние к степени увлажненности [3].
Аналогичные результаты были получены 
при сравнении суходольных и пойменных 
популяций дуба черешчатого (
Quercus robur
Коэффициент генетической дистанции между 
суходольными и пойменными насаждениями 
по отдельным локусам составил 0,09, что в 
два раза превысило значения D
 между раз
личными популяциями суходольных дубрав 
(0,04) и в полтора раза – между популяциями 
пойменных дубрав (0,06). Полученные данные 
для дуба черешчатого также подтверждают от
сутствие существенных геномных различий 
между различными экологическими форма
Генный поток является одним из ведущих 
факторов, направленных на снижение уровня 
межпопуляционной дифференциации и под
разделенности. По литературным данным, 
интенсивность генного потока, превышаю
щая одного мигранта на поколение, является 
достаточной для нивелирования процессов 
дрейфа генов [10]. Оценка влияния интен
сивности генного потока на популяционно-
генетическую структуру лесных древесных 
видов была изучена на основании анализа 
гаплотипической структуры насаждений с 
использованием маркерных локусов хло
ропластной ДНК. В качестве исследуемых 
видов были выбраны дуб черешчатый, ель 
европейская (
Picea abies
) и сосна обыкно
венная. Выбор данных видов был связан со 
следующими биологическими особенностя
ми: установлено, что у покрытосеменных 
растений (дуб черешчатый) хлДНК пре-
имущественно наследуется по материнской 
линии и распространение гаплотипов проис
ходит посредством разноса семян, у голосе
менных растений (сосна обыкновенная, ель 
европейская) – по отцовской линии – рас
пространение гаплотипов осуществляется 
за счет разлета пыльцы [3]. Отличительной 
характеристикой эффективности расселения 
пыльцы и семян является дальность — дан
ный показатель пыльцы на несколько поряд
ков превышает аналогичный параметр для 
семян (плодов) и в особенности для (желу
дей) дуба [11]. 
Анализ хлоропластной ДНК дуба череш
чатого с использованием шести микроса
теллитных маркеров (
μcd4

μcd5

μkk4

μdt1
μdt3

μdt4
) позволил выявить на территории 
Беларуси 18 различных аллельных вариан
тов, образующих 17 различных гаплотипов 
(комбинаций). При этом, пять из них явля
лись доминирующими (долевое участие в 
составе дубрав варьирует от 7% до 48%), 
остальные 12 обнаружены на ограниченных 
территориях (табл.
1). Важным моментом, 
связанным с особенностями распределения 
гаплотипов на изученной территории, яв
ляется их групповой характер, с формиро
ванием выраженных границ областей рас
пространения. Кроме того, в большинстве 
изученных насаждений дуба черешчатого, 
находящихся в зоне перекрытия областей 
распространения, количество выявляемых 
гаплотипов в пределах популяции не пре
вышало двух [7].
Молекулярная и прикладная генетика. Том 20, 2016
г.
 Оценка влияния различных факторов на формирование генетической структуры... 
Таблица 1 
Долевое участие гаплотипов дуба черешчатого на территории Беларуси, %
Обозначение 
гаплотипа
Область
Республика 
Беларусь
Брестская
Витебская
Гомельская
Гродненская
Минская
Могилевская
11
Остальные
15 (12*)
* – количество редких гаплотипов, выявленных на исследуемой территории
Анализ распределения гаплотипов хлДНК 
для ели европейской и сосны обыкновенной 
отличался от описанной структуры, выявлен
ной для дуба черешчатого.
Так, микросателлитный анализ трех локу
сов хлДНК 
P.
аbies
, даже в пределах только 
одного естественного насаждения (Прошков
ское лесничество, Двинская эксперименталь
ная лесная база), позволил диагностировать 
пять вариантов гаплотипов (A, B, C, D, E). 
Изучение смежного искусственного насаж
дения (быстрорастущие лесные культуры, 
созданные заслуженным
лесоводом
Беларуси 
Е.Г.
Орленко) показал наличие только трех 
вариантов гаплотипов (A, B, C). При этом 
быстрорастущие формы (серия Ор) в 70% 
случаях были представлены гаплотипом
хлДНК, в то же время встречаемость дан
ного гаплотипа в природном насаждении не 
превышала 13%. Различия в частотах встре
чаемости и отсутствие гаплотипов D и E у 
быстрорастущих форм, по всей видимости, 
связаны с ограниченным числом отцовских 
особей, участвовавших в опылении, и низкой 
частотой встречаемости данных гаплотипов 
в природных популяциях [12].
В ходе изучения генетической структуры 
деревьев сосны обыкновенной из 20
геогра
фически удаленных насаждений по шести 
SSR-локусам хлоропластной ДНК (PCP 1289, 
PCP 87314, PCP 71987, PCP 30277, PCP 26106, 
PCP 4507) был выявлен 31
аллельный вариант. 
При этом среди проанализированных локусов 
у пяти (PCP 1289; PCP 87314; PCP 71987; PCP 
26106, PCP 4507) в изученных популяциях до
минировал один аллельный вариант (частота 
встречаемости 60–80%), для локуса PCP 30277 
частота основного аллеля не превысила 45% 
то
же
время, следует отметить, что ана
лиз гаплотипического разнообразия хлДНК 
деревьев сосны обыкновенной показал, что в 
исследуемых популяциях было идентифици
ровано 116 комбинаций гаплотипов, большин
ство из которых (63%) были уникальными для 
насаждения и имели частоту встречаемости в 
отдельно взятых популяциях менее 5%. Остав
шаяся часть хлоротипов была представлена в 
изучаемой выборке в бóльшем количестве, но 
не превышающем 15%. При этом одинаковые 
варианты встречались у деревьев, как из одно
го, так и из разных насаждений. Также следу
ет особо подчеркнуть, что каждая популяция 
характеризовалась сложной гаплотипической 
структурой – было диагностировано наличие 
от 6 до 11 вариантов одновременно [13].
Важной особенностью гаплотипической 
структуры сосновых насаждений являлось 
отсутствие доминирующих хлоротипов. Так, 
средняя частота встречаемости наиболее рас
пространенного варианта, в среднем по всем 
насаждениям, не превысила 9%. Представлен
ность остальных вариантов гаплотипов была 
ниже 5%. Проведенный анализ географиче
ской изменчивости в большинстве случаев 
выявил дисперсное распределение для всех 
вариантов гаплотипов хлДНК в изученной ча
сти ареала 
P. sylvestris
Кроме изучения хлоропластной ДНК, для 
хвойных видов была дополнительно изучена 
популяционно-генетическая структура с ис
пользованием митохондриальных маркеров. 
Молекулярная и прикладная генетика. Том 20, 2016
г.
 Оценка влияния различных факторов на формирование генетической структуры... 
отличие от хлоропластной ДНК, митохон
дриальный геном передается у хвойных по ма
теринской линии и связан с распространением 
семян. Анализ локуса mt15-D02 
P. abies
 выявил 
в Беларуси только два основных гаплотипа, при 
этом альтернативный гаплотип был обнаружен 
исключительно в юго-западном регионе рес-
публики [7]. В целом характер распределения 
гаплотипов мтДНК ели европейской совпадал 
данными, полученными для хлДНК дуба, что 
указывает на сходство процессов формирования 
популяционно-генетической структуры для локу
сов, характеризующихся материнским наследо
ванием и связанных с распространением семян: 
низкий уровень гаплотипического разнообразия 
популяций, групповой характер географическо
го распределения гаплотипов, с формированием 
выраженных границ областей распространения, 
ограниченное число комбинаций гаплотипов 
вследствие отсутствия рекомбинации.
Таким образом, по результатам проведен
ных исследований, нами установлено, что ген
ный поток, осуществляемый через миграцию 
пыльцы, вносит более существенный вклад в 
обмен генетическим материалом между на
саждениями и нивелированием уровня межпо
пуляционных различий, по сравнению с рас
пространением наследственной информации 
через семенное потомство.
Интрогрессивная гибридизация также мо
жет оказывать влияние на формирование осо
бенности генотипической структуры популя
ций. Так, отсутствие строгой репродуктивной 
изоляции между симпатрическими видами 
robur
 и 
, наряду с интенсивным 
пыльцевым потоком, зачастую приводит к об
разованию фертильных межвидовых гибридов 
и появлению в ходе дальнейших скрещиваний 
различных вариантов гибридного потомства 
[15]. В ходе исследований с использовани
ем SSR-маркеров проведена сравнительная 
оценка генетической структуры потомства, 
получаемого при различных вариантах скре
щивания 
Q.
robur
 и 
Q.
petraea
. Полученные 
результаты кластеризации групп по уровню 
генетического сходства выявили соответствие 
с биологическими особенностями каждого 
из типов (по происхождению) потомства, что 
указывает на формирование различных гено
типических вариаций, отличных от исходных 
видовых форм [16].
Сходные процессы межвидового потока 
генов выявлены и для симпатрических видов 
берез 
B.
pendula 
(диплоид) и 
B.
pubescens 
(те
траплоид). В
ходе анализа видовой структу
ры смешанных насаждений березы повислой 
и березы пушистой с использованием SSR-
маркеров в структуре древостоев выявлены 
гибридные растения, имеющие триплоидный 
набор хромосом [6]. Частота встречаемости 
межвидовых гибридов варьировала среди 
насаждений, что может быть связано с раз
личиями по долевому участию 
B. pendula
и 
B. pubescens
, фенологическими и репро
дуктивными особенностями генотипов [17]. 
Проведенное рядом авторов изучение спо
собности межвидовых гибридов 
B.
pendula
B.
pubescens
 к плодоношению и образованию 
пыльцы показало пониженную фертильность 
или ее полное отсутствие. Исходя из этого, 
эффективная численность популяции при со
вместном произрастании березы повислой и 
березы пушистой зачастую является ниже рас
четной, что, по всей видимости, может оказы
вать определенное влияние на формирование 
популяционно-генетической структуры [3]. 
Наличие генного потока между видами под
тверждается выявлением в популяциях каждо
го из видов нехарактерных для них аллельных 
вариантов [18].
Кроме прямого влияния на уровень меж
популяционных различий, трансформация 
генетической структуры, как было показано 
различными авторами, в большинстве случаев 
оказывает воздействие на уровень генетичес-
кой изменчивости, что связано с изменением 
параметров аллельного и генотипического 
разнообразия, количественного соотношения 
генотипов, представленных в гомозиготной и 
гетерозиготной форме и др. [1, 2]. Исходя из 
этого, на следующем этапе исследования бы
ло изучено опосредованное (через изменение 
генетической структуры) воздействие боль
шинства изученных ранее факторов на уровень 
генетического полиморфизма насаждений.
Так, для проведения сравнительного ана
лиза популяций видов, характеризующихся 
различиями по структуре и размеру ареала, 
были использованы усредненные значения 
основных показателей генетического поли
морфизма белорусских насаждений 
B.
nana
(табл.
Молекулярная и прикладная генетика. Том 20, 2016
г.
 Оценка влияния различных факторов на формирование генетической структуры... 
Таблица 2 
Усредненные значения основных показателей генетического полиморфизма для белорусских 
популяций березы повислой и березы карликовой (RAPD-анализ)
Доля полиморфных локусов
Число аллелей
Ожидаемая гетерозиготность
Как следует из таблицы, значения всех рас
считанных показателей генетического поли
морфизма для популяций березы повислой 
характеризовались бóльшими величинами, по 
сравнению с данными, установленными для 
березы карликовой. Таким образом, получен
ные результаты указывают на усиление про
цессов дрейфа генов и потери генетического 
разнообразия для насаждений березы карли
ковой, вследствие уменьшения эффективной 
численности популяций в сочетании со сни
жением уровня обмена генетической инфор
мации между ними [7].
Интересными оказались результаты срав
нения показателей генетического разнообра
зия популяций березы пушистой и березы 
повислой (табл.
3). Данные виды характе
ризуются значительным морфологическим 
сходством, однако они различаются по пло
идности. Поэтому одна из задач данного ис
следования заключалась в изучении влияния 
изменения плоидности на показатели гене
тической изменчивости популяций. Установ
лено, что у березы пушистой (тетраплоид) не 
произошло увеличения значения показателя 
числа аллелей (RAPD-анализ), а сами алле
ли являлись сходными с вариантами, най
денными у березы повислой. В то же время 
усредненный для исследованных популяций 
показатель ожидаемой гетерозиготности, с 
иcпользованием набора RAPD-локусов, для 
березы пушистой составил 40,2%. Таким об
разом, удвоение числа хромосом у березы 
пушистой более, чем в два раза увеличило 
долю генов, представленных у одного рас
тения различными аллельными вариантами 
(табл.
3).
В ходе оценки влияния условий произраста
ния на уровень генетического полиморфизма 
был проведен сравнительный анализ параме
тров изменчивости экологических форм дуба 
черешчатого (пойменный и суходольный эко
типы). Результаты исследований представле
ны в табл.
Таблица 3
Усредненные значения основных показателей генетического полиморфизма 
для белорусских насаждений березы повислой и березы пушистой (RAPD-анализ)
Доля полиморфных локусов
Число аллелей
Ожидаемая гетерозиготность
Таблица 4
Сравнительная характеристика генетических параметров пойменного и суходольного 
экотипов дуба черешчатого на основе RAPD-маркеров
Показатель
экотип
Суходольный
экотип
Доля полиморфных локусов (P
Среднее число аллелей на локус (A)
Молекулярная и прикладная генетика. Том 20, 2016
г.
11
 Оценка влияния различных факторов на формирование генетической структуры... 
Показатель
экотип
Суходольный
экотип
Эффективное число аллелей (n
Ожидаемая гетерозиготность (H
Внутрипопуляционная генетическая изменчивость (H
связанных с репродуктивной стратегией ви
дов, определяющих эффективность межви
дового скрещивания и направленность про
цессов обмена генетической информацией. 
Исходя из базовых постулатов классической 
генетики, наличие постоянных интенсивных 
процессов гибридизации, по всей вероятности, 
должно оказывать влияние на уровень генети
ческой изменчивости – приводить к увеличе
нию аллельного разнообразия, уровня гетеро
зиготности (вследствие наличия гибридного 
потомства) и степени генотипического разно-
образия. Одновременно с этим, анализ литера
турных и экспериментальных данных для ряда 
древесных видов выявил несоответствие по
лученных результатов общепринятой модели 
межвидовой гибридизации, что, по всей види
мости, может быть объяснено избирательным 
характером скрещивания (совместимости) ге
нотипов различных видов [1, 15, 17].
Так, например, для симпатрических видов 
дуб черешчатый – дуб скальный был выяв
лен ассиметричный характер генного потока 
в популяциях [15]. Избирательный харак
тер скрещивания, как было показано в ряде 
исследований (при проведении серии ис
кусственных скрещиваний и последующей 
оценки гибридного потомства), наибольший 
вклад в репродуктивную изоляцию вносит 
предзиготической барьер. Так, например, 
яйцеклетки 
Q.
petraea
 оплодотворяются в 
основном спермиями этого же вида, в
отли
чие от 
Q.
robur 
[15]. 
Для определения уровня генетического по
лиморфизма для семенного потомства различ
ного типа происхождения были рассчитаны 
показатели генетического полиморфизма с 
использованием SSR-маркеров. Установлено, 
что наименьшим уровнем наблюдаемой ге
терозиготности (40–43%) характеризовалось 
гибридное потомство, происходящее от ис
ходных видов – 
Q.
robur 
Q.
petraea
, что, с 
одной стороны, противоречит биологической 
Продолжение табл. 4
Как следует из табл. 4, средние значения 
показателей доли полиморфных локусов и 
среднего числа аллелей на локус для обоих 
экотипов составили 1,00 и 2,00, соответствен
но. Эффективное число аллелей в пойменных 
популяциях в среднем равнялось 1,58, в сухо
дольных – 1,57. Средний уровень ожидаемой 
гетерозиготности в пойменных и суходольных 
насаждениях составил 0,347 и 0,338, соответ
ственно. Таким образом, исходя из получен
ных данных, достоверной взаимосвязи между 
общим уровнем генетического полиморфизма 
и экологическими условиями произрастания 
выявлено не было [7].
Аналогичные результаты были получены 
для суходольных и болотных насаждений сос-
ны обыкновенной – межпопуляционные раз
личия для большинства рассчитанных пара
метров полиморфизма находились в пределах, 
выявленных между экологическими формами 
[7]. В среднем значение доли полиморфных 
локусов составило 0,052±0,009, среднего чис
ла аллелей на локус – 1,52±0,15, ожидаемой 
гетерозиготности – 0,234±0,022. 
Таким образом, проведенное сравнительное 
изучение уровня генетической изменчиво
сти популяций древесных видов, произрас
тающих в различных экологических услови
ях, не выявило существенных различий, что 
также подтверждает предположение о на
личии ограниченного числа генов, детерми
нирующих приспособленность к почвенно-
гидрологическому режиму. В
то
же
время 
установленные рядом авторов особенности 
характера генетического полиморфизма для 
некоторых экологических условий местопроиз
растания популяций, по всей видимости, могут 
быть связаны с действием некоторых сторон
них факторов, а не ассоциированы с формиро
ванием адаптивного уровня изменчивости [3].
Исследование влияния процессов интро
грессивной гибридизации на уровень генети
ческой изменчивости выявило ряд аспектов, 
Молекулярная и прикладная генетика. Том 20, 2016
г.
 Оценка влияния различных факторов на формирование генетической структуры... 
концепции процесса гибридизации, но, с дру
гой стороны, может быть объяснено ограни
ченным числом индивидуумов, участвующих 
в скрещивании, вследствие наличия репро
дуктивного барьера – несовпадения сроков 
цветения, прогамной несовместимости и др. 
[16]. Для исходных видов значение H
 состави
ло 70,2% (
robur
) и 58,3% (
). При 
этом уровень ожидаемой гетерозиготности 
у гибридных индивидов был выше в случае 
материнских растений 
Q.
robur
 (78,2%), по 
сравнению с
Q.
petraea 
(57,4%), тем самым 
дополнительно подтверждая избирательный 
характер опыления дуба скального. Исходя 
из полученных данных, наибольшим уровнем 
наблюдаемой гетерозиготности среди гибрид
ного потомства характеризовались индивиды, 
происходящие от гибридных материнских рас
тений. Увеличение доли гетерозиготных дере
вьев может быть обусловлено бóльшим коли
чеством вариантов генотипов, участвующих 
в скрещивании, и высокой репродуктивной 
пластичностью всей группы в целом.
Следует отметить, что группа полусибсово
го потомства дуба скального, полученная от 
гибридных материнских растений, характе
ризовалась сходными значениями параметров 
ожидаемой и наблюдаемой гетерозиготности, 
что, по всей видимости, связано с однородно
стью выявленной для них генетической струк
туры. Для групп растений, представленных 
Q. robur 
 Q. petraea
, уровень наблю
даемой гетерозиготности был несколько ниже 
ожидаемого, указывая на наличие инбредных 
процессов, происходящих при естественном 
Противоречивые данные, связанные с ге
нетическими аспектами процессов межви
довой гибридизации, отмечаются и для сим
патрических видов береза повислая – береза 
пушистая. Рядом исследователей также уста
новлена несовместимость при взаимном опы
лении. Результаты проведенных диаллельных 
скрещиваний показали, что в 30% случаев эти 
виды не скрещивались, а в остальных случаях 
полученые полные семена составляли 50% 
от всего количества. При этом наилучшие 
результаты гибридизации были получены 
при опылении цветков 
B. pendula
 пыльцой 
B.
pubescens
 [19]. Детальные исследования 
потомства 10 полусибсовых семей березы по
вислой показали, что только 0,2% из них были 
гибридами между 
B. pendula
 × 
B. pubescens
[18]. Другим аспектом, как указывалось ра
нее, является пониженная фертильность или 
ее полное отсутствие у гибридов по причине 
их триплоидности. Несмотря на наличие не
значительного дополнительного аллельного 
разнообразия, уровень наблюдаемой гетеро
зиготности у межвидовых гибридов не пре
высил аналогичный показатель, выявленный 
для популяций березы пушистой [7].
Заключение
В результате проведенной работы установ
лены основные факторы, оказывающие влия
ние на генетическую структуру и уровень ге
нетического разнообразия популяций лесных 
древесных видов. Среди факторов, приводя
щих к увеличению уровня генетической диф
ференциации и уменьшению генетического 
полиморфизма, наибольшее значение имеют 
географическая и репродуктивная изоляция, 
низкая эффективная численность популяций 
и эффект основателя. Интенсивный генный 
поток, интрогрессивная гибридизация и пре
валирование панмиксии приводят к снижению 
межпопуляционных различий и увеличению 
уровня генетического разнообразия. В целом, 
полученные данные указывают на необхо
димость учета влияния вышеперечисленных 
факторов при проведении популяционных 
исследований лесных древесных растений, 
разработке мероприятий по сохранению гено
фонда видов и совершенствовании стратегии 
селекционного семеноводства. 
Список использованных источников
1. Hamrick, J.L. Allozyme diversity in plant 
species // Plant Population Genetics, Breeding 
and Genetic Resources. Chapter 3 / J.L.
Ham
rick, M.J.W. Godt; editors: A.H.D.
Brown 
et
al.
– Sinauer Associates, Inc., Sunderland, MA, 
– P. 43–63.
2. Nevo, E. The evolutionary signi�cance of ge
netic diversity: ecological, demographic and life 
history correlates / E. Nevo, A. Beiles, P.
Ben-Shlo-
mo // Lect. Notes Biomath.
– 1984.
– Vol.
P.
3. Which DNA Marker for Which Purpose. 
Final Compendium of the Research Project De
velopment, optimisation and validation of mo
Молекулярная и прикладная генетика. Том 20, 2016
г.
 Оценка влияния различных факторов на формирование генетической структуры... 
lecular tools for assessment of biodiversity in 
forest trees in the European Union / E.M. Gillet 
(lead.), DGXII Biotechnology FW IV Research 
Programme Molecular Tools for Biodiversity.
4. Гончаренко, Г.Г. Руководство по исследо
ванию хвойных видов методом электрофоре
тического анализа изоферментов / Г.Г.
Гонча
ренко, В.Е.
Падутов, В.В.
Потенко.
– Гомель: 
Полеспечать, 1989.
5. Березовые леса Беларуси: Типы, ассоци
ации, сезонное развитие и продуктивность / 
под. общ. ред. И.Д.
Юркевича.— Минск: На
вука i
тэхнiка, 1992.
6. Кузенева, О.И. Род береза – 
Betula
 L. // 
Флора СССР.
– М.-Л., 1936.
– Т.
5.
– С.
269–305.
7. Молекулярно-генетические аспекты ис
следования лесных древесных видов растений 
/ В.Е.
Падутов [и
др.] //
Генетические
основы 
селекции растений: в
т. Т.
4. Биотехнология 
в селекции растений. Геномика и генетиче
ская инженерия / науч. ред. А.В.
Кильчевский, 
Хотылева. – Минск: Беларуская навука, 
8. Юшкаускайте, А. Фенотипическая пла
стичность полусибсовых семей сосны обык
новенной и связь пластичности с полимор
физмом ядерной ДНК / А. Юшкаускайте, 
Баранов, В. Балюцкас // Наука
– инно
вационному развитию лесного хозяйства: ма
териалы международной научно-практической 
конференции, Гомель, 13–17 ноября / Инсти
тут леса НАН Беларуси; ред.: А.И.
Ковалевич 
– Гомель: Институт леса НАН Белару
9. Особенности генотипической структуры 
популяций сосны обыкновенной, различаю
щихся условиями гидрологического режима / 
Падутов [и
др.] // Проблемы лесоведения 
и лесоводства: сб. науч. трудов Института леса 
НАН Беларуси. – Вып.
– Гомель: ИЛ НАН 
Беларуси, 2007.
10. Slatkin, M. Gene �ow in natural populations 
/ M.
Slatkin // Ann. Rev. Ecol. Syst.
– 1985.
Vol.
– P.
11. Качалов, А.А. Деревья и кустарники / 
Качалов.
– М.: Лесная промышленность, 
12. Баранов, О.Ю. Молекулярно-генетичес-
кий анализ быстрорастущих форм ели евро
пейской (
Picea abies
 (L.) Karst.) / О.Ю.Баранов, 
В.Е. Падутов // Генетика и биотехнология 
века: проблемы, достижения, перспекти
вы: материалы междун. науч.-практ. конф., по
свящ. 100-летию со дня рождения академика 
Н.В.
Турбина, Минск, 8–11
октября 2012
г. / 
Институт генетики и цитологии НАН Белару
си; редкол.: А.В.
Кильчевский [и
др.]. – Минск, 
13. Молекулярно-генетический анализ по
лусибсового потомства сосны обыкновен
ной с различным уровнем экологической 
пластичности / О.Ю. Баранов [и
др.] // Со
хранение лесных генетических ресурсов 
Сибири: материалы 4-го международного 
совещания, Барнаул, 24–29
августа / Ин-т 
леса им.
В.Н.
Сукачева СО
РАН; редкол.: 
В.В.
Тараканов [и
др.].
– Барнаул, 2015.
С.
9–10.
14. Paprastosios pušies populiacijų genetinė 
struktūra Lietuvoje pagal chloroplastų 
DNR žymenis / D.
Kavaliauskas [et
al.]. – 
– 2015. – Vol.
1 (77).
– P.
15. Nuclear and organelle diversity in Quer
cus robur and Q. petraea / A.
Kremer [et
al.] // 
Genetic variation in European populations of 
forest trees.
– Germany: Sauerländer, 1991.
P.
16. Генетическая структура полусибсового 
потомства дуба черешчатого и дуба скально
го различного происхождения (SSRP-анализ)
Баранов [и
др.] // Весцi НАН Беларусi. 
Сер. бiял. навук.
17. Phylogenetic relationships of Betula spe
cies (Betulaceae) based on nuclear ADH and 
chloroplast MATK sequences / P.
Jarvinen [et
al.] 
// American Journal of Botany. – Vol.
91(11).
– P.
18. Балюцкас, В. Морфолого-генетическая 
характеристика межвидовых гибридов (
B.
pen
dula
 pubescens
) в полусибсовом потомстве 
березы повислой / В. Балюцкас, А. Балюцкене, 
О.Ю. Баранов // Наука о лесе XXI: материалы 
международной научно-практической конфе
ренции, Гомель, 17-19 ноября / Институт леса 
НАН Беларуси; ред.: А.И. Ковалевич [и
др.].
Гомель: Институт леса НАН Беларуси, 2010.
19. Hagman M. On self–and cross–incompat
ibility shown by 
Betula verrucosa
 Ehrh. and 
Betula pubescens
 // Ehrh. Commun. Inst. Forest. 
– Vol.
– P.
Молекулярная и прикладная генетика. Том 20, 2016
г.
 Оценка влияния различных факторов на формирование генетической структуры... 
O.Yu. Baranov, D.I. Kagan, V.E. Padutov
ALUAT
N TH
 VAR
US FACT
 AN
 VAR
ST 
ULAT
The Institute of Forest of the National Academy of Sciences of Belarus
Gomel BY-246001, Republic of Belarus
In this article, the in�uence of different factors (size and habitat structure, geographic and reproductive barriers to 
the exchange of genetic material between stands; introgressive hybridization; anthropogenic and biotic factors, leading 
to �uctuations in the effective population size; breeding and genome organization features) on the formation of the 
genetic structure and the level of genetic variability of populations on the example of the main forest tree species of 
 population genetic structure, genetic variation, DNA markers.
Дата поступления статьи 12 февраля 2016 г.
Молекулярная и прикладная генетика. Том 20, 2016
г.
УДК 633.854.54:631.524.84
С.И. Вакула
, Н.В. Анисимова
, В.В. Титок
, В.Н. Леонтьев
, Л.В. Хотылева
Кильчевский
МНОГОМЕРНЫЙ СТАТИСТИЧЕСКИЙ АНАЛИЗ ГЕНЕТИЧЕСКОЙ 
ИЗМЕНЧИВОСТИ
 ЛЬНА МАСЛИЧНОГО
Институт генетики и цитологии НАН Беларуси
Республика Беларусь, 220072, г. Минск, ул. Академическая, 27; e-mail:
ГНУ «Центральный ботанический сад НАН Беларуси»
Республика Беларусь, 220012, г. Минск, ул. Сурганова, 2в
Белорусский государственный технологический университет
Республика Беларусь, 227006, г. Минск, ул. Свердлова, 13а
На основании оценки корреляционных связей в коллекции сортов льна масличного различного эколого-
географического происхождения выделены четыре группы признаков, характеризующих: 1) продуктивность; 
2) состав семян; 3) жирнокислотную композицию масла и 4) уровень накопления запасных соединений фос
фора. Выделенные комплексы признаков использованы для оценки 
-кластерной структуры исследуемого сор-
тимента. Применение AMOVA для разделения меж- и внутригрупповой изменчивости RAPD- и ISSR-локусов 
позволило оценить уровень молекулярно-генетической дивергенции между кластерами сортов.
Ключевые слова:
 лен масличный, корреляционная плеяда, кластерный анализ, 
AMOVA
Введение
дой количественных признаков, так и эффекта
ми генетической комплементации и эпистаза. 
Целью данного исследования являлась оценка 
изменчивости коллекции сортов льна маслич
ного различного эколого-географического про
исхождения и идентификация сортов-доноров, 
обладающих благоприятным сочетанием 
хозяйственно-ценных признаков. Подходы к 
комплексной оценке изменчивости включали 
поиск ассоциаций признаков и анализ законо
мерностей их проявления в структуре коллек
ционного генофонда. 
Масличный морфотип льна культурного (
Li
num usitatissimum
 L.) выращивают, главным 
образом, для получения семян, используемых 
в производстве круп, быстросохнущих олиф 
и жидких сиккативов, косметических и ле
карственных препаратов. Для культуры льна 
масличного показана широкая фенотипиче
ская изменчивость признаков продуктивно
сти и качества семян. В зависимости от сорта 
и условий произрастания высота растений 
льна может составлять 30-80 см, вес тысячи 
семян
– 5-9 г [1], концентрация α-линоленовой 
кислоты (АЛК) в масле семян
– от 3 до 70% 
[2]. Химический состав семян льна определя
ет основное направление их хозяйственного 
использования. Так, содержание АЛК в кули
нарном льняном масле составляет около 3%, а 
в техническом
– более 50% [3]. Создание сор-
тов с комплексом хозяйственно-ценных при
знаков, отвечающих требованиям различных 
отраслей промышленности,
– основная задача 
современной селекции льна масличного.
В основу любого селекционного процесса за
ложены оценка изменчивости исходного матери
ала и поиск путей ее использования. В
этом отно
шении возможности простого фенотипического 
скрининга ограничены как полигенной приро
Материалы и методы 
Материал исследования
– коллекция 25 об
разцов льна масличного различного эколого-
географического происхождения: Antares, Mi
vast, Atalante (Франция); Blue Chip (Болгария); 
Glenelg (Австралия); Deep Pink (Нидерланды); 
Linota, SU-1-10, Omega, (США); К-5827 (Уруг
вай); Gold Flax, McGregor, Somme, Л-6582, 
К-6570, Flanders (Канада); Raluca, Sandra (Че
хия); Cyan (Польша); K-2398 (Китай); Воро
нежский, К-5627, Небесный (Россия); ЛМ-1, 
ЛМ-2, (Беларусь). Полевой опыт (2005-2009
гг.) 
и учет морфологических признаков проводили 
согласно «Методическим рекомендациям по 
селекции и семеноводству льна-долгунца» [4]. 
Молекулярная и прикладная генетика. Том 20, 2016
г.
С.И. Вакула и др.
 Многомерный статистический анализ генетической изменчивости льна масличного
Содержание масла в семенах льна устанавлива
ли по сухому остатку после экстракции в аппа
рате Сокслета [5]. Определение жирных кислот 
проводили по методу Welch с модификациями 
[6]. Для
оценки содержания запасного белка в 
образцах семян использовали метод Кьельдаля 
[7]. Выход растворимых полисахаридов из во
дного экстракта семян рассчитывали гравиме
трически, после осаждения 98%-ным этиловым 
спиртом [8]. Для оценки содержания в образцах 
семян фитина и неорганических фосфатов (P
использовали методы Латта и Эскин [9] и Лоури-
Лопеса [10], соответственно. Термогравиметри
ческий анализ (термоанализатор ТА-4000 Met
tler Toledo STARe System, Швейцария) образцов 
семян проводили в интервале 25–500
°С при 
скорости нагревания 5
°С/мин и расходе воздуха 
200
мл/мин. Кривые потери массы рассчитывали 
при помощи программного обеспечения STARe 
[11]. Для элементного анализа зольного остатка 
семян использовали электронный микроскоп 
JSM-5610 LV, оснащенный системой химиче
ского анализа EDX JED-2201 JEOL (Япония) 
[12]. Исследования молекулярной гетерогенно
сти коллекции проводили на основе RAPD- (8 
праймеров) и ISSR-ПЦР (12
праймеров). Для 
статистической обработки экспериментальных 
данных использовали MS Excel
2007 (описа
тельная статистика), Statistica
10.0 (корреляци
онный анализ и итеративная кластеризация по 
методу 
-средних), SPSS Statistics (таблицы со
пряженности), Arlequin
3.5 [13] (анализ молеку
лярной дисперсии AMOVA).
Для выявления значимых ассоциаций при
знаков в коллекции сортов льна масличного 
использован непараметрический корреля
ционный анализ Спирмена. Между 25
при
знаками показано наличие 59
статистически 
достоверных связей, 36
из
которых пред
ставляют обратные зависимости. Сила связи 
между исследуемыми признаками варьирует 
от слабой (
0,2 между содержанием паль
митиновой и стеариновой кислот) до тесной 
>0,9 между признаками формы и размера 
семян, содержанием α-линоленовой и лино
левой кислот). Группы признаков, описы
вающие продуктивность и качество семян 
льна, относительно независимы. Достоверная 
ассоциация показана только между массой 
1000
семян и содержанием масла, что отра
жает сопряженность отбора этих признаков 
при окультуривании льна масличного [1, 3]. 
На
основании полученных данных иссле
дуемые признаки разделены на
корреля
ционные плеяды (см. рис.), объединяющие 
признаки: 1)
морфологии семян (площадь, 
периметр, длина, ширина, фактор формы и 
удлинение) и продуктивности (техническая 
длина стебля, количество коробочек, семян с 
растения и семян в коробочке, масса семян с 
растения, масса 1000
семян); 2)
содержания 
в семенах масла, белка, зольных веществ и 
растворимых полисахаридов (далее
– состав 
семян); 3)
жирнокислотного состава масла 
(йодное число, содержание α-линоленовой, 
линолевой, олеиновой, стеариновой и паль
митиновой кислот); 4)
содержания запасных 
соединений фосфора (процентное содержа
ние фосфора в золе семян, содержание фи
тина, неорганического фосфата (P
) и коэф
фициент фитин/P
Проведен анализ сходства сортов коллек
ции по характеру проявления выделенных 
комплексов признаков. Для
решения задачи 
оптимального разбиения коллекции на
груп
пы фенотипически близких сортов использо
вали итеративный алгоритм кластеризации 
(метод 
-средних) [14], реализованный в па
кете Statistica
10.0. Количество 
-кластеров 
для разбиения определяли по результатам 
усечения иерархии в графике объединения 
сортов агломеративного кластерного ана
лиза. Из
тринадцати признаков, описываю
щих морфологию семян и продуктивность, 
Результаты и обсуждение
Проведена оценка характера проявления 25 
хозяйственно-ценных признаков у 25 образцов 
льна масличного из селекционных регионов, 
охватывающих страны Северной Америки, 
Западной и Восточной Европы, Азию. Оцен
ка мер среднего уровня (среднее арифметиче
ское, мода, медиана, асимметрия и т.д.) показа
ла соответствие эмпирического распределения 
признаков закону нормального распределения. 
Наибольшую вариабельность в коллекции 
сортов льна проявляют признаки семенной 
продуктивности (
% для массы и количества 
семян с растения составил соответственно 
27,6 и 27,5), содержание полиненасыщенных 
жирных кислот (
% 60,0) и растворимых по
лисахаридов (
Молекулярная и прикладная генетика. Том 20, 2016
г.
С.И. Вакула и др.
 Многомерный статистический анализ генетической изменчивости льна масличного
Рисунок.
 Значимые коэффициенты корреляции, показанные для 25 хозяйственно-ценных признаков льна 
масличного
Признаки продуктивности:
 ПВП
– продолжительность вегетационного периода, с; ТД
– техническая длина 
стебля, см; КР
– количество коробочек с растения, шт., СР
– количество семян с растения, шт; СвК
– количество 
семян в коробочке, шт; МСР
– масса семян с растения, г; М1000
– масса 1000
семян, г; S
– площадь семян, мм
– периметр семян, мм; Дл
– длина семян, мм; Шр
– ширина семян, мм; ФФ
– фактор формы; Уд
– удлинение 
семян. 
Состав семян, % от массы:
 Зола (зольные вещества); Белок; Масло; РП (растворимые полисахариды). 
Концентрации жирных кислот в масле, %:
 АЛК
– α-линоленовой; ЛК
– линолевой; ОК
– олеиновой; СК
стеариновой; ПК
– пальмитиновой; ЙЧ
– йодное число масла. 
Запасные соединения фосфора: 
Фитин мг/г; 
– неорганический фосфат мг/г; P
– фосфор зольного остатка, % массы.
итерировано 5
-кластеров, объединяющих 
фенотипически близкие сорта льна (табл.
1). 
Наиболее дистантный 
-кластер сформиро
ван высокопродуктивным, мелкосемянным 
сортом Flanders. Анализ комплексов призна
ков состава семян и жирнокислотной ком
позиции масла разбил коллекцию сортов на 
пять и семь групп, соответственно. Высокое 
содержание растворимых полисахаридов и 
масла определяют удаленность сорта Flanders 
от
других 
-кластеров, сформированных по 
сходству состава семян. На
основании про
веденной оценки выделен кластер, объеди
няющий сорта со средним накоплением масла 
45%, а также кластер сортов, перспектив
ных для селекции на повышение кормовой 
ценности семян (содержание белка
– более 
21,0%). Уникальное соотношение жирных 
кислот отмечено в семенах сортов McGregor 
(эквивалентный уровень линолевой и олеино
вой кислот) и
Gold Flax (низколиноленовый 
сорт). Согласно сходству профилей накопле
ния запасных соединений фосфора в коллек
ции выделено 6
групп сортов. Низкие уровни 
фосфорсодержащих соединений накаплива
ют семена сорта Gold Flax. В
один 
-кластер 
объединены и наиболее высокофитиновые 
сорта BlueChip и
ЛМ-2.
С использованием 
-критерия подтвержде
на достоверность различий среднекластерных 
значений (при α≤0,05) для 22
признаков. Для 
комплекса признаков продуктивности ста
тистически не значим вклад признака «фак
тор формы». Средние величины содержания 
зольных компонентов и пальмитиновой кис
лоты в группах сортов, сгруппированных по 
признакам состава семян и композиции мас
ла, соответственно, также достоверно не раз
личаются. Исходя из значений евклидовых 
дистанций между центрами 
-кластеров (EE), 
максимальной дивергенцией характеризуются 
группы сортов льна, раскластеризованные по 
сходству состава семян (ЕЕ
1,62). Низкий 
уровень расхождения отмечен для 
-кластеров, 
сгруппированных на основании признаков 
продуктивности и формы семян (ЕЕ
При генотипировании сортов коллекции с ис
пользованием маркерных систем RAPD и ISSR 
получено 218
ампликонов, 120
из
которых поли
морфны. Информационный индекс (PIC) 20
до
минантных мультилокусных маркеров варьиро
вал от
0,06 (ISSR
8a и ISSR
9) до
0,33 (Opaf16). В 
среднем, для анализируемой коллекции частота 
фиксированных рецессивных локусов состави
ла 30%, что указывает на ее сравнительно высо
кое генетическое разнообразие [15, 16]. 
Молекулярная и прикладная генетика. Том 20, 2016
г.
С.И. Вакула и др.
 Многомерный статистический анализ генетической изменчивости льна масличного
Таблица 1
Структура рабочей коллекции льна маличного
Продуктивность
Состав семян
Сорта
Сорта
Дистантные 
ВП 95,1 с.; ТД 43,1 см, 
МСР 0,60 г, М1000  7,22 г
Зола 4,0%; Белок 20,5%; 
ВП 85,6 с., ТД 37,8 см, 
МСР 0,50 г, М1000  6,8 г 
3, 4, 11, 19, 21
Зола 4,1%; Белок 20,6%; 
ВП 96 с., ТД 44,6 см, 
МСР 0,55 г, М1000  5,8 г 
Зола 4,1%; Белок 21,2%; 
8, 11, 14, 15, 16
ВП 105 с., ТД 39,0 см, 
МСР 0,84 г., М1000  5,5 г 
Зола 4,0%; Белок 21,2%; 
ВП 85,6 с., ТД 50,1 см, 
6МСР 0,44 г, М1000  5,3 г
Зола 4,0%; Белок 21,4%; 
жирнокислотная композиция масла
Содержание запасных соединений фосфора
Сорта
Сорта
Дистантные 
5, 6, 7, 11, 16, 18, 19, 
11, 21
11
Примечание. Условные обозначения
– смотри примечания к рисунку. 1
– Antares; 2
– Atalante; 3
– Blue Chip; 
– Cyan; 5
– Deep Pink; 6
– Flanders; 7
– Glenelg; 8
– Gold Flax; 9
– Linota; 10
– McGregor; 11
– Mivast; 12
– Omega; 
– Raluca; 14
– Sandra; 15
– Somme; 16
– SU-1-10; 17
– Воронежский; 18
– K-2398; 19
– K-5627; 20
– K-5827; 
– Небесный. 
Данные молекулярно-генетического поли
морфизма соотнесены со структурой фено
типической изменчивости. Сортовой состав 
-кластеров по признакам продуктивности, 
состава семян, композиции масла и содержа
ния запасных соединений фосфора рассма
тривали как градации четырех независимых 
факторов дисперсионного анализа AMOVA. 
Для оценки значимости каждого компонента 
изменчивости использовали процедуру пере
становок (данные не приведены). Результаты 
оценки доли молекулярно-генетических разли
чий, связанных с разбиением сортимента кол
лекции на 
-кластеры представлены в
табл.
Наиболее высокий процент молекулярно-
генетических различий показан между 
-кластерами, сгруппированными по сход
ству признаков жирнокислотного состава 
масла (19,65%), наиболее низкий
– между 
-кластерами состава семян (7,75%). На основа
нии результатов AMOVA рассчитаны генетиче
ские расстояния между 
-кластерами, так назы
ваемые 
Fst
 для пар популяций. За исключением 
дистанции между односортовыми 
-кластерами 
по композиции масла (Gold Flax и McGregor), 
все 
Fst
 значимо отличались от нуля. 
Молекулярная и прикладная генетика. Том 20, 2016
г.
С.И. Вакула и др.
 Многомерный статистический анализ генетической изменчивости льна масличного
Таблица 2
Распределение изменчивости ДНК-локусов по 
-кластерам сортов коллекции льна масличного
Фактор изменчивости
Между 
Внутри 
Межкластерные дистанции 
(среднее)
Продуктивность
Состав семени
жК состав масла
Запасные соединения P
Проведена оценка зависимости генетических 
расстояний, выраженных в 
Fst
, и соответствую
щих им евклидовых дистанций между центрами 
-кластеров. Для оценки силы связи использо
вали коэффициенты корреляции Спирмена. Для 
факторов «продуктивность», «состав семян», «со
держание запасных соединений фосфора» пока
зана статистически значимая (при α≤0,01) зависи
мость между долей генетических различий (
Fst
и фенотипической удаленностью 
-кластеров 
(EE) (табл.
2). Уровень количественных различий 
между 
-кластерами сортов, дивергентных по 
жирнокислотной композиции масла, не отражен 
в их генетических дистанциях, что может быть 
связано с ограниченностью использованного на
бора ДНК-маркеров, влиянием условий среды на 
состав масла льна или другими факторами.
Заключение
Проведена оценка связи между фенотипиче
ской структурой коллекции сортов льна маслич
ного по комплексам признаков продуктивности, 
состава семян, содержания запасных соединений 
фосфора, жирнокислотной композиции мас
ла и генетической гетерогенностью коллекции 
сортов, оцененной с использованием RAPD- и 
ISSR-маркеров. Доля генетической изменчи
вости, выявленная между четырьмя группами 
-кластеров с использованием AMOVA, варьи
ровала от 7,75% для фактора «состав семян» до 
19,65% для фактора «композиция масла». Зна
чимая корреляция межкластерных расстояний, 
выраженных в
ЕЕ (фенотипическая дистанция) 
Fst
 (генетическая дистанция), может свиде
тельствовать о накоплении в кластерах аллель
ных вариантов, связанных с фенотипическим 
проявлением комплексов признаков продуктив
ности, состава семян и
содержания запасных 
соединений фосфора. Селекционная работа с 
выделенными в
структуре коллекции группами 
фенотипически и генотипически сходных сор-
тов может способствовать дальнейшему на
коплению благоприятных сочетаний аллелей, 
включение их в скрещивания
– созданию со
ртов льна масличного, отвечающих требованиям 
различных отраслей промышленности. 
Список использованных источников
1. Черноморская, Н.М. К вопросу о внутри
видовой классификации льна обыкновенного 
Linum usitatissimum
 L.) / Н.М.
Черноморская, 
Станкевич // Селекция и генетика техни
ческих культур.
– Т. 113.
2. Diederichsen, A. Cultivated �ax and the ge
 L. Taxonomy and germplasm conser
vation / A.
Diederichsen, K.
Richards // Flax The 
– P.
3. Duguid, S.D. Flax / S.D. Duguid // Oil Crops. 
Handbook of Plant Breeding.
– 4-th
ed.
– NY., 
– P. 233–256.
4. Методические указания по проведению 
полевых опытов со льном-долгунцом
– Л: 
5. Комплексный анализ состава семян льна 
масличного
– оптимизация подходов для се
лекционной практики / В.В.
Титок [и
др.] // 
Труды БГТУ: Химия, технология органиче
ских веществ и биотехнология.
– 2014.
– №
6. Welch, R.W. A Micro-method for the Esti
mation of Oil Content and Composition in Seed 
Crops / R.W.
Welch // J.
Sci. Food Agr.
– 1977.
Vol.
– P.
7. Kjeldahl, J. Neue Methode zur Bestimmung 
des Stickstoffs in organischen Körpern (New meth
od for the determination of nitrogen in organic sub
stances) / J.
Kjeldahl // Zeitschrift für analytische 
Chemie
– 1883.
– Vol.
22, №
1.
– P.
366–383.
Молекулярная и прикладная генетика. Том 20, 2016
г.
С.И. Вакула и др.
 Многомерный статистический анализ генетической изменчивости льна масличного
8. Оленников, Д.Н. Исследование процесса 
экстракции полисахаридов семян льна (
Linum 
 L.) / Д.Н.
Оленников, Л.М.
Тан
хаева // Химия растительного сырья.
– 2007.
9. Latta, M. A simple and rapid colorimetric 
method for phytate determination / M.
Latta, 
Eskin // J.
Agr. Food Chem.
– 1980.
– Vol.
– P.
10. Скулачев, В.П. Соотношение окисления 
и фосфорилирования в дыхательной цепи / 
Скулачев.
– М.: Наука, 1962.
11. Термический анализ и сканирующая 
электронная микроскопия с электронно-
зондовым микроанализом в комплексных ис
следованиях структуры биологических объ
ектов: [для сельскохозяйственных культур] 
/ В.Н.
Леонтьев [и
др.] // Материалы, техно
логии, инструменты.
– 2005.
– Т.
10, №
4.
109–115.
12. Analysis of Structural and Qualitative Fea
tures of Phytin Deposition in Ripe Flax Seeds 
/ V.
Titok [et
al.] // Cytology and Genetics.
– Vol.
– P.
13. Excof�er, L. Arlequin suite ver 3.5: A new 
series of programs to perform population genetics 
analyses under Linux and Windows / L.
Excof�er, 
H.E.L.
Lischer // Molecular Ecology Resources.
– P.
14. Боровиков, В.П. Популярное введение в 
современный анализ данных в системе STA
TISTICA / В.П. Боровиков.
– М.: Горячая ли
– Телеком, 2015.
15. RAPD Analysis of 54 North American Flax 
Cultivars / Y.-B.
Fu [et
al.] // Crop Sci.
– 2003.
Vol.
– P.
1510–1115.
16. Лемеш, В.А. Молекулярные маркеры в 
изучении генетических ресурсов/ В.А.
Лемеш 
// Молекулярная и прикладная генетика: сб. 
науч. тр.
– Т.
.I. Vakula
.V. 
, V.V. 
, V.
.V. Khotyleva
.V.
MULT
IV
AR
AT
TAT
ST
CAL 
NAL

OF
 TH
 FLAXS
EED

AR
BI
Institute of Genetics and Cytology of the National Academy of Sciences of Belarus
Minsk BY-220072, Republic of Belarus
The Central Botanical Garden of the National Academy of Sciences of Belarus
Minsk BY-220012, Republic of Belarus
Belarusian State Technological University
Minsk BY-227006, Republic of Belarus
Four groups describing 1) the yield, 2) seed composition, 3) fatty acid ratio and 4) reserved phosphorus were 
identi�ed based on their correlative relations in the collection of �axseed varieties. These complexes were used for 
characterizing structure of k-means clusters for studied �axseed varieties. For the estimation of molecular-genetic 
divergence level between k-clusters we estimated RAPD and ISSR variability between and among extracted groups 
with the use of AMOVA.
AMOVA
Дата поступления статьи 23 февраля 2016 г.
Молекулярная и прикладная генетика. Том 20, 2016
г.
УДК 575.113:577.633
О.В. Дубровная, И.И. Лялько, А.В. Бавол, С.С. Воронова, А.Н. Гончарук 
ТРАНСГЕННЫХ
РАСТЕНИЙ
ПОЛУЧЕННЫХ
МЕТОДОМ
ОПОСРЕДОВАННОЙ
ТРАНСФОРМАЦИИ
КУЛЬТУРЕ
Институт физиологии растений и генетики Национальной академии наук Украины
03022, Украина, г. Киев, ул. Васильковская, 31/17; e-mail: [email protected]
Исследовано прохождение мейоза у генетически модифицированных растений пшеницы сорта Зимоярка, 
полученных при 
Аgrobacterium
-опосредованной трансформации в культуре 
vitro
 и методом 
. Вы
явлено, что трансгенные формы характеризируются большей частотой нарушений мейоза по сравнению с не
трансгенными растениями. В результате сравнительного анализа течения мейоза установлено, что у трансген
ных линий, полученных при использованиии штамма AGLO с векторной конструкцией pBi2E, процент клеток 
с нарушениями на стадии метафазы 1 был значительно ниже, а мейотический индекс соответственно выше, 
чем у линий, полученных при использовании штамма AGLO с векторной конструкцией pBi-ОАТ. Показано, 
что наибольшее количество клеток с нарушениями
– у трансгенных растений линий с пониженной фертиль
ностью пыльцы и низкой семенной продуктивностью. 
Ключевые слова:
Triticum aestivum
Agrobacterium
-опосредованная трансформация, мейоз.
уровня плоидности [6–8]. Кроме того, стрессы, 
связанные с различными аспектами трансфор
мации растений, такие, как использование ан
тибиотиков и инфекция 
Agrobacterium
, также 
могут вызвать генетические и / или эпигенети
ческие изменения в геноме [9]. В связи с этим, 
была начата разработка других подходов, по
зволяющих избежать культивирования 
in
vitro
и возможной сомаклональной изменчивости, 
в частности, метод 
[10]. Этот метод 
успешно используется у различных злаковых 
культур, в том числе и пшеницы [11, 12]. 
Известно, что при трансгенезе инсерция 
Т-ДНК в функционально значимые области 
генома может негативно влиять на мейоз и 
фертильность пыльцы, а также на репродук
тивные функции растений-трансформантов 
[13–17]. Описаны мутации, происходящие на 
различных стадиях микро- и макроспороге
неза, а также гаметогенеза [18]. Нарушения 
нормального течения мейоза у растений про
являются в изменениях синапсиса, замене 
первого мейотического деления на митоти
ческое, преждевременном цитокинезе, из
менении конденсации хроматина, слипании 
и фрагментации хромосом, неспособности 
хромосом к конъюгации, в образовании раз
личного количества унивалентов, неодновре
Введение
В последние десятилетия наблюдается ши
рокое использование различных подходов для 
создания генетически модифицированных рас
тений пшеницы, одним из которых является 
Agrobacteium
-опосредованная трансформация. 
Данный метод позволяет вводить в геном ре
ципиента ограниченное число копий генов и 
обеспечивает передачу относительно больших 
генетических конструкций с минимальными 
перестройками в кодирующих последователь
ностях переносимых генов [1, 2]. 
Основные способы получения генетически 
модифицированных растений при использо
вании метода 
Agrobacterium
-опосредованной 
трансформации основаны на переносе Т-ДНК 
в культивируемые 
in
vitro
 клетки с после
дующей регенерацией трансформирован
ных побегов [3]. Однако при 
Agrobacteium
опосредованной трансформации в культуре 
vitro
 могут возникать генетические и эпи
генетические изменения генома
[4, 5]. Уста
новлено, что встраивание Т-ДНК может при
водить к появлению всего спектра мутаций, 
описанных классической генетикой,
– от то
чечных мутаций до значительных хромосом
ных перестроек, таких, как транслокации, 
инверсии, дупликации, и даже к изменению 
Молекулярная и прикладная генетика. Том 20, 2016
г.
Анализ мейоза у трансгенных растений пшеницы, полученных методом...
менном и неравномерном расхождении хромо
сом к полюсам, формировании диад и тетрад 
с микроядрами, появлению полиад [16–19]. 
Наблюдаются также аномалии мейоза, свя
занные с аппаратом веретена деления [13]. В 
зависимости от встраивания Т-ДНК, инсерции 
могут стать причиной эмбриолетальности, 
мужской стерильности, а также часто приво
дят к снижению семенной продуктивности и 
стерильности растений [20]. В связи с этим, 
целью нашей работы был сравнительный ана
лиз протекания мейоза у генетически моди
фицированных растений пшеницы, получен
ных методом 
Аgrobacterium-
опосредованной 
трансформации как клеток каллусных культур 
vitro
 [21], так и методом 
pBi-ОАТ. Все исследуемые растения в поколе
нии Т
 имели нормальный хромосомный набор 
(2n   6х   42) и были фертильными. 
Цитологический анализ мейоза проводили 
на материнских клетках пыльцы (МКП) на 
временных давленых препаратах пыльников, 
окрашенных 2%-ным ацетокармином, 
приготовленных по общепринятой методике 
[24]. Для каждого варианта брали по 3–4 коло
са, еще не вышедших из трубки. Анализирова
ли все пыльники, МКП которых находились на 
стадиях профазы 1 (П1), метафазы 1 и 2 (М1, 
М2), анафазы 1 и 2 (А1, А2) и формирования 
тетрад. В диакинезе и метафазе 1 изучали по 
15–20 четких метафазных пластинок на пре
парат, а на стадиях ана/телофаз
– не меньше 
клеток на колос. На последней стадии мей-
оза анализировали по 150–200 тетрад на одно 
растение, определяли мейотический индекс 
(количество МКП без нарушений на данной 
стадии), который является четким показателем 
как нормального прохождения мейоза, так и 
окончательным показателем уровня цитоло
гической стабильности генотипов [25, 26]. В 
качестве контроля использовали растения ис
ходного сорта Зимоярка (К1) и нетрансгенные 
растения R
 того же сорта, полученные в куль
туре 
vitro
 (К2). Препараты анализировали с 
помощью микроскопа Аmplival (Zeiss) с увели
чением 15
× 40 и 15
× 100. Фертильность пыль
цы определяли по стандартной методике [24].
Материалы и методы
В исследованиях использовали растения мяг
кой пшеницы сорта Зимоярка (оригинатор
– Ин
ститут физиологии растений и генетики НАН 
Украины). 
Agrobacterium-
опосредованную 
трансформацию проводили с использованием 
штамма AGLO и двух векторных конструк
ций, одна из которых несет ген синтеза,
а дру
гая
– катаболизма пролина [21–23]. Векторная 
конструкция pBi2E содержит двухцепочечный 
РНК-супрессор гена пролиндегидрогеназы 
pdh
) и ген 
nptII
– неомицинфосфотрансфера
зы
II 
E.
coli
. Другая конструкция содержит би
нарный вектор pBi-ОАТ с целевым геном ор
нитинаминотрансферазы 
Medicago truncatula
а также селективный ген неомицинфосфо
трансферазы
ІІ (
nptІІ

E.
сoli
. Обе конструкции 
любезно предоставлены д.б.н. А.В.
Кочетовым 
(Институт цитологии и генетики СО
РАН, г.
Но
восибирск). Трансгенный статус регенерантов 
подтверждали методом ПЦР. 
Материалом
исследований служили транс
генные линии пшеницы сорта Зимоярка, по
лученные при 
Аgrobacterium
-опосредованной 
трансформации 
in
planta
:  Зимоярка 32р, 74р, 
86р
– с использованием векторной конструкции 
pBi2E, линии Зимоярка 93р, 126р, 134р
– с ис
пользованием векторной конструкции pBi-ОАТ. 
Трансгенные линии Зимоярка 1, 11, 43, 59 полу
чены методом 
Agrobacterium-
опосредованной 
трансформации в культуре 
in
vitro
 с использо
ванием векторной конструкции pBi2E, тогда 
как линии Зимоярка 154, 161, 169, 175 получе
ны с использованием векторной конструкции 
Результаты и обсуждение
Цитологический анализ микроспорогенеза 
у контрольных растений сорта Зимоярка по
казал, что мейоз проходил практически без 
нарушений. Хромосомные ассоциации в мета
фазе мейоза 1 (М1) представлены, в основном, 
закрытыми бивалентами (21з
II
). У нетранс
генных растений R
 только в единичных клет
ках отмечены открытые биваленты (20
). Все биваленты были расположены 
на экваторе микроспороцитов, а их центроме
ры ориентированы к полюсам веретена деле
ния. Клеток с унивалентами у растений сорта 
не наблюдали, а у нетрансгенных растений 
 отмечена лишь одна клетка с унивалента
ми (20
II
 + 2
), что соответствует нормально
му течению мейоза. На стадиях ана-телофаз 
обоих мейотических делений только в от
дельных клетках отмечали присутствие еди
Молекулярная и прикладная генетика. Том 20, 2016
г.
Анализ мейоза у трансгенных растений пшеницы, полученных методом...
ничных фрагментов, частота которых у сорта 
составляла 0,5%, а у нетрансгенных растений 
 была на уровне 1,7%, что в 3 раза выше по 
сравнению с растениями сорта, однако не пре
вышает нормы для цитологически стабильных 
форм. Формирование нормальных тетрад про
исходило в гнездах пыльников синхронно, ко
личество клеток с микроядрами не превышало 
1,5%. Таким образом, полученные данные сви
детельствуют о том, что мейоз у контрольных 
растений происходит без нарушений и они яв
ляются цитологически стабильными.
При изучении
характера микроспорогенеза у 
трансгенных растений пшеницы, полученных 
как методом 
vitro,
 так и методом 
наблюдали, в основном, однотипные откло
нения от нормы. Установлено, что у всех ли
ний формировались бивалентные ассоциации 
хромосом, представленные в основном за
крытыми бивалентами (21
II
), что свидетель
ствует о высокой интенсивности конъюгации 
гомологичных хромосом. Практически у всех 
проанализированных растений встречалось 
от 1-го до 3-х открытых бивалентов: 20
или 19
II
+2
II
 (рис., б), появление которых 
свидетельствует о десинапсисе (ослаблении 
конъюгации), однако показано, что он не имеет 
негативного влияния на прохождение мейоза 
[25]. Мультивалентные ассоциации хромосом 
в наших исследованиях не обнаружены.
Основным типом нарушений на стадии М1 
является асинапсис (отсутствие конъюгации) 
между гомологичными хромосомами, на что 
указывает наличие унивалентных хромосом. 
Асинапсис приводит к аномалиям мейоза на по
следующих стадиях [8].
Отсутствие конъюгации 
и образование разного количества унивалентов 
объясняется мутациями в генах, контролирую
щих синапсис [26].
В наших исследованиях 
наблюдались в основном микроспороциты с 
двумя унивалентами (20
II
+ 2
), только у линий 
Зимоярка
169 и
126р отмечены единичные клет
ки с
четырьмя (рис., г) и тремя унивалентами 
(19
II
+4
20
II
+3
) соответственно. Наличие трех 
унивалентов свидетельствует о присутствии в 
данном кариотипе анеуплоидных клеток. Счита
ется, что одной из причин возникновения таких 
клеток может быть цитомиксис [13]
Рисунок
. Нарушения мейоза в клетках генетически модифицированных растений пшеницы: а
– анафаза 1 с вы
бросом хромосомы; б
– открытые биваленты; в
– метафаза
2 с выбросом хромосом; г
– наличие 4-х унивалентов; 
– анафаза
2 с асинхронным делением; е
– множественные нарушения в анафазе
1 (мост, выброс хромосом и
от
стающая хромосома); ж
– тетрада с отсутствующей микроспорой; и
– тетрада с микроядром; к
– тетрада с
двумя 
отсутствующими микроспорами; л
– триада; м
– пентада; н
– клампинг хромосом
Молекулярная и прикладная генетика. Том 20, 2016
г.
Анализ мейоза у трансгенных растений пшеницы, полученных методом...
Как правило, унивалентные хромосомы 
располагались за пределами метафазной 
пластинки и не принимали участия в ее фор
мировании. Такие хромосомы оставались в 
цитоплазме (рис., а), а на стадии телофазы 
образовывали микроядра. Другим наруше
нием на стадиях метафазы 1 и 2 было нали
чие клеток с выбросом хромосом (рис., в). 
В мейоцитах, которые имеют униваленты, в 
основном происходит случайное расхожде
ние хромосом в анафазе 1, что в дальнейшем 
может приводить к образованию неполноцен
ных гамет. Количество клеток с унивалента
ми составляло от 3,8 до 22,4% у линий, полу
ченных при 
Аgrobacterium
-опосредованной 
трансформации 
in
planta
 и от 6,7 до 20,4% 
у линий, полученных при трансформации 
in
vitro
Нарушения, наблюдавшиеся на стадии А1, 
представлены отставшими хромосомами, 
фрагментами, мостами, выбросом хромосом 
(табл.
1). Количество таких клеток колебалось 
в пределах от 2,0 до 17,4%
у линий, получен
ных при 
Аgrobacterium
-опосредованной транс
формации 
in
vitro
, и в пределах от 4,8 до 18,7% 
у линий, полученных при трансформации 
. Однако следует отметить, что среди 
исследуемых линий нами обнаружена одна 
(Зимоярка
126р) со значительными системны
ми нарушениями мейоза, которая характери
зовалась высоким уровнем аномалий мейоза 
(18,7%). При цитологическом исследовании в 
поле зрения микроскопа часто выявляли клет
ки с множественными нарушениями (рис., е), 
а также наблюдали (одновременно) сразу не
сколько клеток с нарушениями.
Таблица 1
Нарушения мейоза, отмеченные на стадиях А1 и А2
Генотип
Количество 
изученных 
клеток, шт.
Всего 
нарушений, 
Отстающие 
хромосомы, 
Фрагменты, 
Мосты, 
Выброс 
хромосом, 
Асинхронные 
-опосредованная трансформация 
Контроль 1
Контроль 2
Векторная конструкция pBi2E 
Зимоярка 1
Зимоярка 11
Зимоярка 43
Зимоярка 59
Векторная конструкция pBi-ОАТ
Зимоярка 154
Зимоярка 161
11,6±2,1
Зимоярка 169
Зимоярка 175
-опосредованная трансформация 
Контроль
Векторная конструкция pBi2E
Зимоярка 32р
Зимоярка 74р 
Зимоярка 86р
11,6±1,8
Векторная конструкция pBi-ОАТ 
Зимоярка 93р
Зимоярка 126р
Зимоярка 134р
Молекулярная и прикладная генетика. Том 20, 2016
г.
Анализ мейоза у трансгенных растений пшеницы, полученных методом...
Из фрагментов и/или целых отставших хро
мосом, которые не отходили вместе с другими 
к полюсам и оставались в цитоплазме, в тетра
дах на стадии Т2 образовывались микроядра 
(рис., и). Основными нарушениями на стадии 
А2 также были отставание или выброс хромо
сом. Кроме того, на стадиях ана-телофазы от
мечали клетки с асинхронным делением, когда 
в одной клетке проходила поздняя анафаза / 
ранняя телофаза, в то время как во второй
– ме
тафаза (рис., д). Частота таких клеток у линий 
была различной и варьировала в пределах от 
0,7 до 3,9%. (табл.
На стадии Т1 происходит формирование ди
ад. Показано, что к этому времени отставшие 
хромосомы и фрагменты, которые оставались 
в цитоплазме и не отходили к полюсам, могут 
элиминироваться, включаться в одно из тело
фазных ядер или образовывать микроядра [27]. 
Одним из характерных нарушений на этой 
стадии были асимметричные деления, в ре
зультате которых к полюсам отходило разное 
количество хромосом. Тетрады с микроядрами 
отмечались с различной частотой у всех про-
анализированных линий (табл.
2). Наибольшее 
количество таких клеток (28,1%) отмечено у 
линии Зимоярка
175, наименьшее (0,7%)
– у 
линии Зимоярка 1. Кроме того, у отдельных 
линий (Зимоярка
161 и
169) наблюдали те
трады, в которых одна или две микроспоры 
отсутствовали (рис., ж, к). Количество таких 
клеток не превышало 2%. Появление в тетра
дах безъядерных микроспор некоторые иссле
дователи объясняют наличием в М1 или М2 
Таблица 2
Анализ стадии тетрад и мейотический индекс
Генотип
Стадия тетрад
Мейотический 
индекс,
Количество изученных 
клеток, шт.
Норма
С микроядрами, %
Отсутствуют 
микроспоры, %
-опосредованная трансформация 
Контроль 1
Контроль 2
Векторная конструкция pBi2E
Зимоярка 1
Зимоярка 11
Зимоярка 43
Зимоярка 59
Векторная конструкция pBi-ОАТ
Зимоярка 154    
Зимоярка 161
Зимоярка 169
Зимоярка 175
-опосредованная трансформация 
Контроль 
Векторная конструкция pBi2E
Зимоярка 32р
Зимоярка 74р
Зимоярка 86р
Векторная конструкция pBi-ОАТ
Зимоярка 93р
Зимоярка 126р
Зимоярка 134р
Молекулярная и прикладная генетика. Том 20, 2016
г.
Анализ мейоза у трансгенных растений пшеницы, полученных методом...
практически невозможно различить отдельные 
хромосомы. В анафазе хромосомы «растяги
вались» и к полюсам отходило разное количе
ство хроматина. Цитологическое проявление 
этой мутации практически не отличалось от 
описанного Соснихиной у ржи [28]. Микро
споры, образующиеся в конце мейоза, имеют 
неравное количество хроматина, различаются 
по размеру ядер и могут быть стерильными. 
Частота таких клеток была на уровне 2%.
Нами также проводилось определение фер
тильности пыльцы у исследуемых линий. На 
цитологических препаратах фертильная пыль
ца окрашивалась ярким карминно-красным 
цветом и имела зернистую цитоплазму с четко 
сформированными двумя спермиями и вегета
тивным ядром. Стерильные пыльцевые зерна 
почти не окрашивались кармином. Результаты 
анализа фертильности пыльцы подтверждают, 
что линии с низким мейотическим индексом 
характеризуются пониженной фертильностью 
Показано, что интеграция Т-ДНК в геном 
растений при 
Аgrobacterium-
опосредованной 
трансформации не является сайт-специфичной 
и носит случайный характер, что приводит к 
различного рода мутациям и хромосомным 
перестройкам генома растений, которые мо
гут сказываться на репродуктивной способ
ности растений-трансформантов [6, 7, 14, 15]. 
Встраивание в геном трансформантов пшеницы 
генетических конструкций с использованием 
Аgrobacterium
-опосредованной трансформации 
также неспецифично и может приводить к раз
личным структурным изменениям хромосом. 
Эти изменения незначительно отражаются на 
морфологии растений, но в разной степени на
рушают ход мейоза, что приводит к различной 
динамике снижения завязывания семян. Сле
дует отметить, что у
некоторых
линий процент 
клеток с нарушениями в разы превышает кон
трольные. Кроме того, линии с низким мейоти
ческим индексом характеризуются пониженной 
фертильностью пыльцы и, как следствие, низ
кой завязываемостью семян. У линий Зимоярка 
74р, 86р, 126р, 134р она составляла 30–40% от 
контроля (растения сорта Зимоярка, завязыва
ние семян которых принимали за 100%). Это 
может быть связано либо с прямым действием 
агробактерии на растительные клетки, либо 
с опосредованным влиянием, поскольку ино
автономного веретена, а также отсутствием ки
нетохорных фибрилл или аномальным преж-
девременным цитокинезом в профазе 2 [26].
В конечном итоге это может приводить к 
снижению фертильности или полной стериль
ности пыльцы

В ходе исследования отмечали 
и другие аномалии
– триады (рис., л), пентады 
(рис., м), а иногда полиады.
Исследование показателей мейотического 
индекса у трансгенных растений, получен
ных путем 
Аgrobacterium
-опосредованной 
трансформации 
vitro
, показало, что три из 
проанализированных линий имеют высокий 
индекс
– 90–99% (линии Зимоярка 1, 11, 154); 
две
– сниженный
– 75–78% (линии Зимоярка 
43, 59) и три
– низкий
– 68–72% (линии Зимо
ярка 161, 169, 175). 
Подобная картина наблюдалась и при 
Аgrobacterium
-опосредованной трансформа-
ции 
in
planta
: две линии
– Зимоярка 32р и 93р
с высоким мейотическим индексом (94,2 и 
91,4%, соответственно); одна
– Зимоярка 86р
с пониженным
– 81,6%, и три
– с низким 59,3, 
71,2 и 74,4% (соответственно линии Зимоярка 
126р, 134р, 74р) (табл.
Высокий мейотический индекс присущ ци
тологически стабильным формам с нормаль
ным течением мейоза, формированием тетрад 
без нарушений и обусловливает в дальнейшем 
образование жизнеспособной пыльцы. По го
дам воспроизведения трансгенные растения 
этих линий по продолжительности фенологи
ческих стадий роста практически не отлича
лись от контрольных растений сорта Зимоярка. 
Это свидетельствует в пользу стабилизации 
функционирования генома в целом у потомков 
первичных трансформантов уже в следующем 
поколении. Сниженный мейотический индекс 
характерен для стабильных форм, которые 
имеют определенное количество нарушений в 
метафазе. Низкий мейотический индекс свиде
тельствует о повышенном уровне нарушений 
на стадиях М1–А2 и является показателем не
стабильности таких материалов.
Следует отметить, что кроме описанных на
рушений у линий Зимоярка 86р и Зимоярка 
126р наблюдали отдельные пыльники, в клет
ках которых происходил клампинг (слипание) 
хромосом (рис., н). В первой метафазе мейо
за суперконденсированные хромосомы были 
тесно сближены, образуя «комки», в которых 
Молекулярная и прикладная генетика. Том 20, 2016
г.
Анализ мейоза у трансгенных растений пшеницы, полученных методом...
куляционная среда богата углеводами, био
логически активными соединениями и может 
стимулировать рост сапрофитной микрофлоры, 
которая негативно влияет на процесс опыления 
и развитие завязи. В то же время у линий Зимо
ярка 32р и 93р завязываемость семян составля
ла 90% от контроля.
Mahalakshmi, A.
 Agrobacterium
gene delivery in various tissues and genotypes of 
wheat (
Triticum 
L) / A.
P.
Khurana // J.
Plant Biochem. Biotechnol.
Vol.
– P.
Genomic changes in transgenic rice (
za sativa
L.) plants produced by infecting calli 
Agrobacterium tumefaciens 
/ M.
al.] // Plant Cell Reports.
– 2001.
– Vol.
P.
Somaclonal variation in transgenic plants 
/ F.
Sala [et
al.] // Acta Horticulture.
– 2000.
Vol.
– P.
411–419.
Laufs, P.
A chromosomal paracentrric in
version associated with T-DNA integration in 
 / P.
Laufs, D.
Autran, J.
Traas // 
– T.
– P.
Дейнеко, Е.В.
Т-ДНК-индуцированные 
мутации у трансгенных растений / 
Дейнеко, А.А.
Загорская, В.К.
Шумный 
// Генетика.
– Т.
Tax, F.
T-DNA-associated duplication/
translocations in 
. Implications 
for mutant analysis and functional genomics / 
F.
Tax, D.
Vernon // Plant Physiology.
– 2001.
Vol.
– P.
Antibiotic-induced DNA methylation 
changes in calluses of 
Arabidopsis thaliana /
al.] // Plant Cell Tissue and Organ 
– Vol.
– P.
Чумаков,
М.И. Технологии агробактери-
альной трансформации растений 
ta /
 М.И.
Чумаков, Е.М.
Моисеева // 
Биотехнология.
11.
Development of simple and ef�cient 
transformation method for wheat 
Triticum aestivum 
L.) using 
Agrobacterium 
tumefaciens / 
P. Supartana [et
al.] // Journal 
of Bioscience and Bioengineering.
– 2006.
Vol.
– P.
Transgenic wheat progeny resistant to 
powdery mildew generated by Agrobacterium 
inoculum to the basal portion of wheat seedling 
/ T.
Zhao [et
al.] // Plant Cell Rep.
– 2006.
Vol.
– P.
1199–1204.
13.
Т-ДНК-индуцированные аномалии цвет-
ков и мужская стерильность у трансгенных 
растений табака: морфологический и 
цитологический анализ / Ю.В.
Сидорчук 

др.] // Цитология и генетика. –2000.
– T.
34, 
6.
– С.
3–8.
Заключение
Таким образом, анализ хода мейоза у генети
чески модифицированных растений пшеницы 
показал, что трансгенные формы характери
зуются большей частотой нарушений мейо
за по сравнению с нетрансгенными. Нами не 
выявлено существенных отличий протекания 
мейоза у генетически модифицированных рас
тений пшеницы, полученных как в культуре 
vitro
, так и методом 
. Проанализи
рованные линии различаются по уровню цито
логической стабильности: среди трансгенных 
растений, полученных различными способами 
Аgrobacterium
-опосредованной трансформа
ции появляются как генетически стабильные, 
так и генетически нестабильны формы, кото
рые имеют значительные нарушения мейоза. 
Показано, что процент клеток с нарушения
ми мейоза был наибольшим у трансгенных 
растений из линий, которые характеризуют
ся низкой семенной продуктивностью. Наши 
результаты показывают, что уровень цитоло
гической стабильности у линий, полученных 
при использовании штамма AGLO с вектор
ной конструкцией pBi2E, выше по сравнению 
с линиями, трансформированными штаммом 
AGLO с векторной конструкцией pBi-ОАТ. 
Возможно, это связано с неспецифическим 
встраиванием генетической конструкции в 
геном пшеницы, что может в разной степени 
нарушать ход мейоза, и является основной 
причиной неодинаковой воспроизводимости 
трансгенных линий. 
Список использованных источников
Bhalla, P.L.
Wheat transformation–an up
date of recent progress / P.L.
Bhalla, H.H.
tenhof, M.B.
Singh // Euphytica.
– 2006.
Vol.
– P.
Transgenic plant regeneration from wheat 
Triticum aestivum 
L) mediated by 
Agrobacte
rium tumefaciens 
G. Xia [et
al.] // Acta Physiol. 
– Vol.
– P.
Молекулярная и прикладная генетика. Том 20, 2016
г.
Анализ мейоза у трансгенных растений пшеницы, полученных методом...
14.
Embryonic lethals and T-DNA insertional 
mutagenesis in Arabidopsis / D.
Errampalli [et
al.] 
// Plant Cell.
– 1991.
– Vol.
3, N
– P.
149–157.
Abnormalities of meiotic division causеd 
by T-DNA tagget mutation in tobacco (
 L.) / N.V.
Shamina [et
al.] // Cell Biol.
– Vol.
4. –P.
Преждевременный цитокинез в мате-
ринских клетках пыльцы трансгенных 
растений табака (
Nicotiana tabacum 
L.) / 
Сидорчук [и
др.] // Цитология.
– 2008.
T.
Peirson, B.N.
A defect in synapsis causes 
male sterility in a T-DNA-tagged Arabidopsis 
thaliana mutant / B.N.
Peirson, S.E.
Makaroff // The
Plant Journal.
– 1997.
Vol.
11. N
– P.
18.
Особенности развития мужской 
репродуктивной сферы инсерционного мутанта 
табака ТРD1 с продолжительным периодом 
цветения / Э.Л.
Миляева [и
др.] // Физиология 
растений.
– 2002.
– T.
42, №
4.
– С.
526–534.
Особенности развития и репродукции 
трансгенних растений льна-долгунца
 / 
Лемеш [и
Онтогенез.
– 2014.
T.
406–411.
Genetic and molecular characterization 
of embryonic mutants identi�ed following seed 
transformation in 
/ L.A.
al.] // Mol.
– 1993.
– Vol.
– P.
21.
Бавол, А.В.
Оптимізація умов 
Agrobacterium-
опосередкованої
трансформації 
калюсів м’якої пшениці / А.В.
Бавол, С.С.
Во
ронова, О.В.
Дубровна // Физиология растений 
и генетика.
– 2015.
– Т.
47, №
1.
– С.
58–65.
Воронова, С.С.
Генетична трансфор
мація 
 м’якої пшениці з викорис
танням штаму AGLO, який містить pBi2E з 
дволанцюговим РНК-супресором гена про
ліндегідрогенази / С.С.
Воронова, А.В.
Бавол, 
Дубровная // Фактори експерт. еволю
ції організмів: зб.наук.праць.
– Київ: Логос, 
– Т.
Гончарук, А.Н. 
Agrobacterium-
середкована
трансформація м’якої пшениці 
 з використанням гена орнітинамі
нотрансферази / А.Н.
Гончарук, А.В.
Бавол, 
Дубровная // Фактори експерт. еволю
ції організмів: зб.наук.праць.
– Київ: Логос, 
– Т.
Паушева, З.П. Практикум по цитологии 
растений / З.П.
Паушева.
– М.: Колос, 1988.
Цитологическое изучение
коллекции 
синтетической пшеницы из национальной 
коллекции злаков США (National Small Grain 
Collection of USDA-AKS) в условиях не
черноземной зоны России / И.Ф. Лапочкина 
др.] // Сельхоз. биология.
– 2014.
– №
Проявление и наследование десинапти-
ческой формы ржи с нарушением гомо-
логичности синапсиса / С.П.
Соснихина 
др.] // Генетика.
– 2007.
– T.
43, №
Создание тетраплоидных форм озимой 
ржи (
Secale cereale
 L.) с использованием 
закиси азота и генетические эффекты 
дупликации генома / Н.Б. Белько [и
// Факторы экспериментальной эволюции 
организмов.
– 2011.
– T.
Молекулярная и прикладная генетика. Том 20, 2016
г.
Анализ мейоза у трансгенных растений пшеницы, полученных методом...
O.V. Dubrovna, I.I. 
.V. Bavol, 
. Voronova, 
C WH
AT PLANTS 
TA
AT
AT
 AN
Institute of Plant Physiology and Genetics, National Academy of Sciences of Ukraine
03022, Ukraine, Kyiv, str. Vasylkivska 31/17
Meiosis in genetically modi�ed wheat plants obtained by 
Agrobacterium
-mediated transformation of 
in vitro
 culture 
in planta
 of bread wheat cv. Zimoyarka has been investigated. It was found that transgenic forms are characterized 
by a higher frequency of meiotic disorders compared to non-transgenic plants. Comparative analysis of meiosis showed 
that transgenic lines obtained using strain AGLO with a vector construct pBi2E have much lower percentage of cells 
with disorders at the metaphase stage 1, and meiotic index is respectively higher than in the lines obtained using strain 
AGLO with a vector construct pBi-OAT. It is shown that the percentage of cells with impaired meiotic was the largest 
in transgenic plants from lines from lines that are characterized by reduced pollen fertility and low seed productivity.
Triticum aestivum 
Agrobacterium
Дата поступления статьи 8 февраля 2016 г.
Молекулярная и прикладная генетика. Том 20, 2016
г.
УДК
атарнов, Т.М. 
атарнова, Т.А. Силкова, Н.С. Фомченко, О.Г. Давыденко
ВЛИЯНИЕ КОМБИНАЦИОННОЙ СПОСОБНОСТИ РОДИТЕЛЬСКИХ 
ЛИНИЙ НА ПОКАЗАТЕЛИ ПРОДУКТИВНОСТИ ГИБРИДОВ 
ПОДСОЛНЕЧНИКА (
S A
Институт генетики и цитологии НАН Беларуси
Республика Беларусь, 220072, г. Минск, ул. Академическая, 27; e-mail: [email protected]
Получены данные
оценке показателей хозяйственно важных признаков 100
гибридов F
 подсолнечника, 
созданных на основе самоопыленных линий белорусской селекции, выделены перспективные комбинации 
скрещивания. Урожайность семян лучших гибридов F
 составила 20,4–25,9
ц/га, масличность семян
– 50,7–
53,9%. Выделены материнские линии M695(8)/07A, M753(3)/07A, M475(15)/07A, M543/1(6)/07A, и отцов
ская
– M708/04Rf, характеризующиеся высокими положительными эффектами ОКС по урожаю, масличности 
семян и урожаю масла. Отцовские линии
– M387/08Rf, M442/08Rf и M444/08Rf
– характеризовались высокой 
вариансой СКС по признакам урожай семян и масла. Раннеспелый межлинейный гибрид подсолнечника F
Белорусский ранний (M475(15)/07A
× M442/08Rf) был районирован в 2015 году по Гродненской, Гомельской, 
Брестской и Минской областям Беларуси.
Ключевые слова:
 гибридный подсолнечник, цитоплазматическая мужская стерильность, инбредные линии, 
общая и специфическая комбинационная способность.
диагностика линий позволяет существенно 
снизить затраты труда селекционера, выбрако
вав заведомо бесперспективные линии [1]. Од
ним из способов такой диагностики является 
оценка комбинационной способности линий. 
Комбинационная способность подразде
ляется на общую (ОКС) и специфическую 
(СКС). ОКС определяется средней величиной 
гетерозиса во всех изученных гибридных ком
бинациях с участием этой линии [1, 2]. СКС 
характеризует степень отклонения величины 
гетерозиса в конкретных комбинациях от сред
ней и позволяет выявить отдельные наиболее 
удачные комбинации скрещивания определен
ных родительских форм.
Таким образом, учитывая возрастающий ин
терес к подсолнечнику в нашей стране, а также 
появление новых и совершенствование старых 
методов и направлений в мировой селекции 
масличных культур, представляет интерес 
дальнейшая селекционная работа с подсолнеч
ником масличным в почвенно-климатических 
условиях Беларуси.
Целью данной работы являлась оценка ком
бинационной способности родительских ли
ний подсолнечника по показателям продуктив
ности гибридов F
Введение
Подсолнечник
– одна из основных маслич
ных культур в мире, которая получила широ
кое признание и распространение на пост
советском пространстве благодаря своим 
высоким пищевым и кормовым достоинствам.
Селекция новых гибридов, обладающих 
довольно высокой экологической пластич
ностью, позволила продвинуть районы воз
делывания этой культуры к более северным 
широтам. 
Практическая работа по селекции подсол
нечника в Беларуси, начатая еще в начале 90-х 
гг. с испытания гибридов и сортов зарубеж
ной селекции, привела к созданию в лабора
тории нехромосомной наследственности Ин
ститута генетики и цитологии НАН Беларуси 
ряда перспективных самоопыленных линий. 
Использование этих линий позволило полу
чить отечественные гибриды F

Поиск (2008) 
и F

Агат (2010), что явилось подтверждением 
перспективности направления гетерозисной 
селекции подсолнечника для региона Бела
руси.
Для развития гетерозисной селекции важно 
оценивать не только сами гибриды, но и са
моопыленные линии подсолнечника. Ранняя 
Молекулярная и прикладная генетика. Том 20, 2016
г.
О.П. Шатарнов и др.
 Влияние комбинационной способности родительских линий на показатели...
Материалы и методы
Результаты и обсуждение
Исследования проводились на эксперимен
тальном поле биологической опытной станции 
Института генетики и цитологии НАН Бела
руси в 2009–2010 годы. Почвы на территории 
станции дерново-подзолистые, легкосуглини
стые, с нейтральной реакцией среды. В работе 
использовались 100 гибридных комбинаций 
подсолнечника F
, полученных от скрещива
ния стерильных линий на цитоплазме 
thus petiolaris

с линиями-восстановителями 
фертильности пыльцы, выделенными нами из 
простых межлинейных гибридов на основе 
ЦМС зарубежной селекции, путем многократ
ного инцухта фертильных растений.
Растения выращивали рeндомизированными 
блоками в 3-кратной повторности. Площадь 
питания одного растения составляла 70
35 см. Согласно общепринятым методикам 
[2], анализировали признаки: высота расте
ний, диаметр корзинки, масса 1000
семян и с 
одной корзинки, урожай семян, масличность 
семян и сбор масла с единицы площади, ко
личество растений, не пораженных 
Sclerotinia 
sclerotiorum
, на стадии физиологической спе
лости корзинок. Стандартом служил райо
нированный в Беларуси гибрид F

Фермер 
(селекции Донского филиала ВНИИМК и 
«Соя-Север Ко»).
Для создания самоопыленных линий ис
пользовали метод инбридинга
– принудитель
ного самоопыления растений. Для этих целей 
применяли пергаментные изоляторы размером 
45
× 45 см, которые одевали на корзинки до 
появления краевых цветков.
Для получения гибридных семян проводи
ли опыление стерильных материнских линий 
восстановителями фертильности пыльцы. Для 
гибридизации использовали изоляторы в виде 
рукавов, сшитых из спанбонда (СУФ-42), раз
мером 80
Комбинационную способность линий оце
нивали в системе 
линия
× тестер
. Величину 
истинного и конкурсного гетерозиса, а так
же расчет эффектов ОКС, констант и варианс 
СКС определяли по общепринятым формулам 
и методам [3–7]. Двухфакторный дисперсион
ный анализ и расчет эффектов общей (ОКС) и 
специфической комбинационной способности 
(СКС) проводили в модуле Grif1 программного 
пакета статистического анализа данных AB-Stat. 
Ценность родительских линий, включенных 
в схему скрещивания, определяется не только 
присутствием у них интересующих исследо
вателя признаков и свойств, но и способно
стью этих форм передавать такие признаки 
потомству и давать гибриды с высокой жиз
неспособностью и продуктивностью. Поэтому 
изучению генетики количественных признаков 
и определению комбинационной способности 
родительских форм в селекционных и гене
тических исследованиях уделяется большое 
внимание. Создание высокогетерозисных ги
бридов у перекрестноопыляемых растений, в 
том числе и подсолнечника, достигается со
четанием приемов инбридинга, оценки ком
бинационной способности самоопыленных 
линий и направленного подбора родительских 
компонентов скрещиваний [2, 8–12]. 
В результате наших исследований дана оцен
ка комбинационной способности для 16
ро
дительских линий в двух схемах тестерных 
скрещиваний: раннеспелые (10
× 2) и средне
спелые(6
× 3). Дисперсионный анализ полу
ченных данных показал наличие достоверных 
различий по основным показателям продук
тивности между исследуемыми гибридами F
подсолнечника (табл.
При схеме скрещивания 6
× 3 отмечены до
стоверные значения ОКС испытанных линий 
по всем анализируемым показателям продук
тивности. Достоверные значения ОКС тесте
ров в данной схеме были получены для мас
личности семян и урожая масла полученных 
гибридов подсолнечника. При анализе компо
нентов генотипической вариансы, а
также от
ношения вариансы ОКС к вариансе СКС было 
отмечено, что в наследовании масличности 
семян преобладали неаддитивные эффекты 
взаимодействия генов родительских линий, 
а в наследовании урожайности семян
– адди
тивные эффекты генов материнских линий, 
что согласуется с данными, полученными за
рубежными исследователями. 
При схеме скрещивания 5
× 2 отмечены до
стоверные значения ОКС испытанных линий 
при двух уровнях вероятности по всем ана
лизируемым показателям продуктивности. 
Для тестеров высокое достоверное значение 
ОКС в данной схеме было получено только 
по масличности семян, что дает возможность 
Молекулярная и прикладная генетика. Том 20, 2016
г.
О.П. Шатарнов и др.
 Влияние комбинационной способности родительских линий на показатели...
использовать их для получения раннеспелых 
высокомасличных гибридов подсолнечника. В 
процессе анализа компонентов генотипической 
вариансы в данной схеме, а также отношение 
вариансы ОКС к вариансе СКС, нами было 
отмечено, что на урожай семян в сильной сте
пени влияет генотип материнских линий, а на 
масличность
– генотип отцовского компонента.
Таблица 1
Дисперсионный анализ комбинационной способности среднеспелых родительских линий 
подсолнечника (схема скрещиваний 6
Источник варьирования
Степени 
свободы
Урожай семян
Масличность семян
Урожай
масла
Повторности
Гибриды
Случайные отклонения
ОКС линий
ОКС тестеров
СКС
Случайные отклонения
Компоненты генотипической вариансы
* – значимо при 
<0,05; ** – значимо при 
Таблица 2
Дисперсионный анализ комбинационной способности раннеспелых родительских линий 
подсолнечника (схема скрещиваний 5
Источник варьирования
Степени 
свободы
Урожай семян
Масличность
семян
Урожай
масла
Повторности
Гибриды
Случайные отклонения
ОКС линий
ОКС тестеров
СКС
Случайные отклонения
Компоненты генотипической вариансы
* – значимо при 
<0,05; ** – значимо при 
Молекулярная и прикладная генетика. Том 20, 2016
г.
О.П. Шатарнов и др.
 Влияние комбинационной способности родительских линий на показатели...
В селекции на раннеспелость гибридов 
представляют большой интерес линии, име
ющие отрицательные значения ОКС по при
знаку «период всходы-цветение», поскольку 
существует положительная корреляция между 
количеством дней от всходов до цветения и 
длиной вегетационного периода растений под
солнечника в целом. 
В табл.
3 представлены эффекты ОКС и ва
рианс СКС родительских линий по урожаю, 
масличности семян и урожаю масла с единицы 
площади, из которых видно, что 2 материнские 
формы (M695(8)/07A, M753(3)/07A) и отцов
ская (М708/04Rf) имели положительные эффек
ты ОКС по исследуемым признакам. Высокой 
вариансой СКС по урожаю семян характеризо
вались линии M753(3)/07A и М387/08Rf, поэ
тому при определенном сочетании они могут 
давать высокоурожайные гибриды, что пред
ставляет интерес для селекции на гетерозис.
В скрещивании пяти материнских линий с 
двумя восстановителями высокие эффекты 
ОКС имела материнская форма M475(15)/07A 
(табл.
Таблица 3
Оценка эффектов ОКС и варианс СКС родительских линий подсолнечника по продуктивности 
гибридов F
 (схема 6
× 3)
Материнские
Урожай семян
Масличность
Урожай масла
-0,11
M709(6)/07A 
11,53
Стандартная ошибка
Стандартная ошибка
Таблица 4
Оценка эффектов ОКС и варианс СКС родительских линий подсолнечника по продуктивности 
гибридов F
 (схема 5
× 2)
Материнские
Урожай семян
Масличность
Урожай масла
Стандартная ошибка
Стандартная ошибка
Молекулярная и прикладная генетика. Том 20, 2016
г.
О.П. Шатарнов и др.
 Влияние комбинационной способности родительских линий на показатели...
Анализ констант СКС по совокупности ана
лизируемых признаков, определяющих про
дуктивность гибридов, позволил выделить 5 
лучших комбинаций скрещивания в пределах 
Это комбинации скрещивания M709(6)/07A
М780/04Rf, M753(3)/07A
× М387/08Rf, 
M475(15)/07A
× М442/08Rf, M597(7)/06A
М444/08Rf и M599(15)/06A
× М444/08Rf. 
Гибриды M695(8)/07A
× М708/04Rf и 
M621(6)/07A
× М780/04Rf имели высокие 
положительные константы СКС по урожаю 
семян и сбору масла.
Важным этапом в анализе полученных дан
ных является установление взаимосвязи пока
зателей гетерозиса у исследуемых гибридов с 
эффектами ОКС и вариансами СКС родитель
Из данных табл.
5 видно, что гетерозис по 
урожаю семян у 14
гибридов был положитель
ным и находился в пределах 4,2–135,4%.
Линия M543/1(6)/07A имела положитель
ные эффекты ОКС и отрицательные вариансы 
специфической комбинационной способности 
(СКС) по урожаю семян и урожаю масла. В то 
время как по масличности у этой линии от
мечалась высокая варианса СКС. Ни у одной 
из отцовских линий не были отмечены поло
жительные эффекты ОКС по всем учитывав
шимся параметрам. Однако у восстановителя 
фертильности М442/08Rf оказалась положи
тельной ОКС по урожаю семян и масла, а у 
– по масличности семян.
При исследовании комбинационной спо
собности линий подсолнечника представляет 
интерес выяснение характера их поведения 
в определенных комбинациях скрещивания. 
Оценка констант СКС отражает отклонение от 
ОКС родительских линий в результате специ
фического взаимодействия генов, т.е. насколь
ко та или иная комбинация скрещивания луч
ше или хуже предполагаемой на основе ОКС. 
Таблица 5
Эффекты гетерозиса (
) по урожаю и масличности семян, а также конкурсный гетерозис 
,) по урожаю масла у гибридов F
 подсолнечника
Гибридные комбинации
Урожай семян,
Масличность,
Урожай масла,
-11,6
11,6
11,3
Молекулярная и прикладная генетика. Том 20, 2016
г.
О.П. Шатарнов и др.
 Влияние комбинационной способности родительских линий на показатели...
Гибридные комбинации
Урожай семян,
Масличность,
Урожай масла,
11,6
11,9
Стандарт F
 Фермер
Продолжение табл. 5
– отклонение от стандарта F
 Фермер
По масличности семян гетерозис был поло
жительным у всех комбинаций скрещивания 
и составлял 2,9-18,6%. «Конкурсный гетеро
зис» (превышение по отношению к стандар
ту) был положительным по всем трем при
знакам у гибридов M475(15)/07A
× M442/08R, 
M543/1(6)/07A
× M442/08Rf, M543/1(6)/07A
M444/08Rf, M695(8)/07A
× M708/04Rf и 
M753(3)/07A
× M387/08Rf. Урожай семян 
у лучших гибридов находился в пределах 
20,4–25,9 ц/га, а масличность
– 50,7–53,9%. 
По урожаю масла отклонение от стандарта у 
них составляло 12,8–54,7%. Материнские ли
нии данных гибридов характеризовались или 
высокими эффектами ОКС обоих родителей, 
или высокими вариансами СКС одного из ро
дителей. Все гибриды, полученные с участи
ем отцовских линий-восстановителей фер
тильности пыльцы М442/08Rf и М444/08Rf, 
за исключением комбинаций скрещивания 
× М442/08Rf и M599(15)/06A
М442/08Rf, были выше по урожаю масла, по 
сравнению со стандартом. 
Гибридная комбинация M475(15)/07A
M442/08Rf, полученная в процессе исследо
вания, успешно прошла государственное сор-
тоиспытание в 2015 году.
Заключение
Таким образом, оценка комбинационной 
способности некоторых родительских форм 
позволила выделить материнские линии 
M695(8)/07A, M753(3)/07A, M475(15)/07A, 
M543/1(6)/07A, и отцовскую M708/04Rf, ха
рактеризующиеся высокими положительны
ми эффектами ОКС по урожаю, масличности 
семян и урожаю масла. Отцовские линии
M387/08Rf, M442/08Rf и M444/08Rf
– с высо
кой вариансой СКС. У гибридов, полученных 
с участием указанных линий, превышение по 
сбору масла с единицы площади, по сравне
нию со стандартом, было разным, в зависимо
сти от комбинации скрещивания, и составляло 
3,5–54,7%. Урожай семян у лучших гибридов 
находился в пределах 20,4–25,9 ц/га, а маслич
ность
Гибрид подсолнечника F
 Белорусский ран
ний (M475(15)/07A
× M442/08Rf) был райо
нирован в Беларуси и стал стандартом для 
ультраранней группы спелости на госсорто-
участках и станциях страны.
Список использованных источников
Fick, G.N. Sun�ower breeding / G.N.
J.F.
Miller // Sun�ower technology and produc
tion. Agronomy
– USA, Madison.
– 1997.
P.
Биология, селекция и возделывание 
подсолнечника / О.И. Тихонов [и
– М.: 
Агропромиздат.
Grif�ng, G.B. A generalized treatment of 
the use of diallel crosses in quantitative inheri
tance / G.B. Grif�ng // Heredity.
– 1956, №
P.31–50. 
A breeding procedure designed to make 
maximum use of both general and speci�c 
combining ability / R.E.
Comstock [et al.] // 
– Vol.
– P.
5.
Kempthorne, O. An introduction of genetic 
statistics / O.
Kempthorne.
– N.-Y., 1957.
– 545
p.
Молекулярная и прикладная генетика. Том 20, 2016
г.
О.П. Шатарнов и др.
 Влияние комбинационной способности родительских линий на показатели...
Турбин, Н.В. О принципах и методах 
селекции растений на комбинационную 
способность / Н.В.
Турбин, Л.В.
Хотылева // 
Гетерозис.
59–110.
Изменчивость эффекта гетерозиса у 
диаллельных гибридов кукурузы в
условиях среды / Л.А.
Тарутина [и
др.] // 
Изменчивость и отбор.
– Минск: Наука
техника.
Пимахин, В.Ф. Методы и результаты 
селекции подсолнечника в Поволжье: 
автореф. дис. … д-ра. с.-х. наук: 06.01.05 / 
Пимахин, Научно-исследовательский 
институт сельского хозяйства Юго-Востока.
Саратов, 2000.
Бурлов, В.В. Изучение реакций само-
опыленных линий и сортов-популяций 
подсолнечника на ЦМС / В.В.
Бурлов, 
Костюк // Научн.-техн. бюлл. ВСГИ.
Одесса.
Hanson, M.R. Plant organelle gene ex
pression: altered by RNA editing / M.R.
Sutton, B.
Lu // Trends Plant Sci.
– 1997, 
– Р.
11.
Havey, M.J. Molecular con�rmation that 
sterile cytoplasm has been introduced into open-
pollinated grano onion cultivars / M.J.
Havey, 
Bark // J.
Am. Soc. Hort.
– 1994.
Vol.
119.
– P.
12.
Horn, R. Molecular diversity of male 
sterility inducing and male-fertile cytoplasms 
in the genus Helianthus / R.
Horn // Theor. 
Appl. Genet.
– 2002.
– Vol.
104.
– P.
562–
570.
O.P. 
hatarnov, 
CT 
 PAR
NTAL 
CAT
Institute of Genetics and Cytology of the National Academy of Sciences of Belarus
Minsk BY-220072, Republic of Belarus
Here we report the data on evaluation of agronomic traits in 100 sun�ower F
 hybrids developed on the basis of self-
pollinated lines of Belarusian breeding. Seed yield of the best F
 hybrids was 2.0–2.6 t/ha, oil content – 50,7–53,9%. 
GCA and SCA effects of parental lines and heterosis effect of F
 hybrids have been evaluated for 3 parameters. Maternal 
lines: M695(8)/07A, M753(3)/07A, M475(15)/07A, M543/1(6)/07A with high positive effects of GCA on yield, oil 
content and oil yield were obtained. The high variances of SCA were demonstrated for M387/08Rf, M442/08Rf and 
M444/08Rf paternal line. The early-ripening interlinear F
 hybrid “Belorusski ranni” (M475(15)/07A × M442/08Rf) 
 hybrid sun�ower, cytoplasmic male sterility, inbred lines, general and speci�c combining ability.
Дата поступления статьи 26 февраля 2016 г.
Молекулярная и прикладная генетика. Том 20, 2016
г.
УДК 577.21;601;633:631.52
О.А. Межнина, О.Ю. Урбанович 
СОРТОВ
САДОВОЙ
ИСПОЛЬЗОВАНИЕМ
МАРКЕРОВ
Институт генетики и цитологии НАН Беларуси
Республика Беларусь, 220072, г. Минск, ул. Академическая, 27; e-mail: [email protected]
Для успешной реализации селекционных программ большое значение имеет идентификация генотипов, как сортов, 
так и гибридов и исходных форм. Сорта земляники садовой имеют значительное внешнее сходство, что затрудняет их 
идентификацию по фенотипическим признакам. В связи с этим, все большее значение приобретает разработка эффек
тивных и надежных методов оценки генетического разнообразия сортов с использованием молекулярных маркеров. 
Молекулярное исследование геномов сортов земляники садовой, выращиваемых в Беларуси, показало, что 
они характеризуются невысоким генетическим разнообразием. SSR-анализ выявил тесную генетическую связь 
изученных сортов селекции Беларуси, России, Германии, Польши и других стран. Предложен набор 8 SSR-
маркеров, обладающий достаточной степенью информативности для идентификации сортов земляники садо
вой отечественной и зарубежной селекции, выращиваемых в Беларуси. Анализ по 8 SSR-маркерам позволил 
выявить 72 различных генотипа, 86 аллелей, в среднем 11 аллелей на маркер.
Ключевые слова:
 земляника садовая, генетическое разнообразие, SSR-маркеры, ДНК-типирование.
технологические качества ягод. Для успешной 
реализации селекционных программ большое 
значение имеет идентификация генотипов, как 
сортов, так и гибридов и исходных форм. Сор-
та земляники имеют значительное внешнее 
сходство, что затрудняет их идентификацию 
по фенотипическим признакам. В
связи с этим 
все большее значение приобретает разработка 
эффективных и надежных методов оценки ге
нетического разнообразия сортов с использо
ванием молекулярных маркеров. 
Для изучения генетического разнообразия 
земляники садовой исследователями разных 
стран были предложены несколько вариантов 
молекулярных маркеров: RAPD [4, 5, 6], AFLP 
[7], ISSR [8]. В 2000 году на основе данных, 
полученных с помощью RAPD-анализа, в суде 
была подтверждена сортовая принадлежность 
линий земляники садовой и защищены права 
селекционеров [9]. Однако каждая из перечис
ленных систем идентификации с неспецифи
ческими праймерами имеет определенные 
проблемы с
воспроизводимостью в различ
ных лабораториях. Этого недостатка лишены 
SSR-маркеры. Результаты, полученные с их 
помощью, легко интерпретируются и
воспроиз
водятся. Помимо этого, микросателлитные мар
керы наследуются по кодоминантному принци
Введение
Земляника (
Fragaria 
L.)
– род
многолетних 
травянистых растений семейства розовых (Ro
saceae Juss., надпорядок Rosanae).
Род
 Fragaria
характеризуется базовым числом хромосом n 7 
и четко выраженным полиплоидным рядом: 
13
диплоидов (2n), 5
тетраплоидов (4n), 1
гек
саплоид (6n), 6
октоплоидов (8n) [1] и
дека
плоид (10n) [2]. Вид 
F.
iturupensis 
изначально 
был описан как октоплоид [1], позднее были 
выявлены его декаплоидные формы 
[2]
. Таким 
образом, в настоящее время данный вид являет
ся единственным декаплоидом рода 
Fragaria
L. 
Самым распространенным культивируемым 
видом является земляника садовая (
Fraga-
ria
 ananassa
), относящаяся к октоплоидам 
(2n 8x 56). Размер ее генома составляет 708–
720 Mb [3]. По данным ФАО, мировое произ
водство земляники садовой за последние годы 
увеличилось и составляет более 59% валового 
производства всех ягод.
 Интенсификация яго
доводства требует использования новых сортов, 
отвечающих возрастающим современным тре
бованиям, среди которых скороплодность и вы
сокая урожайность, отзывчивость на агротех
нику, устойчивость к вредителям и болезням, 
пригодность для механизированного возделы
вания и уборки урожая, высокие товарные и 
Молекулярная и прикладная генетика. Том 20, 2016
г.
О.А. Межнина, О.Ю. Урбанович.
 Идентификация сортов земляники садовой (
пу и
поэтому получили широкое применение 
для картирования генома и анализа генетиче
ской структуры популяции [10]. Первые рабо
ты в данном направлении проводились 
Sargent 
с сотрудниками, которые в 2003
году разрабо
тали и
охарактеризовали набор SSR-маркеров 
для 
Fragaria viridis
, диплоидного представите
ля рода 
Fragaria
L. [11]. Позже эта же группа 
исследователей разработала генетическую кар
ту для межвидового гибрида от скрещивания 
F.
vesca
× 
F.
nubicola
. В
данном исследовании 
было картировано 78
маркеров, среди которых 
68
SSR-маркеров [12].
В 2008 году Govan с сотрудниками разра
ботали сет из 10 пар SSR-маркеров, характе
ризующихся высокой воспроизводимостью и 
информативностью. В исследовании этих ав
торов было охарактеризовано 60 различных 
генотипов земляники садовой селекции США, 
Канады, Японии, Германии, Англии и других 
европейских стран [13]. Дальнейшее изучение 
Brunings с сотрудниками генетического раз
нообразия элитных линий земляники садовой 
с использованием данного набора маркеров 
показало значительное снижение аллельного 
разнообразия селекционных линий по срав
нению с родительскими формами [14]. В 2009 
году Gil-Ariza с сотрудниками исследовали 92 
сорта земляники садовой и показали, что сорта 
земляники, культивируемые в промышленных 
масштабах, обладают значительным генети
ческим сходством. Несмотря на это, данный 
метод позволил достоверно различить каждый 
сорт, а также выявить 3 основные группы в 
рамках исследуемой выборки [15].
В последние годы активно ведутся работы, 
направленные на изучение генетического раз
нообразия земляники садовой, а также поиск 
ген-ассоциированных маркеров для селекции 
по хозяйственно-ценным признакам.
Однако к настоящему времени не существует 
универсальной методики ДНК-идентификации 
земляники садовой, на молекулярном уровне 
изучено ограниченное количество сортов. Сорта 
белорусской селекции остаются неисследованны
ми. Не изучено, каким генетическим потенциалом 
они обладают, и какие наборы маркеров эффек
тивны для их идентификации. В связи с этим, 
данное исследование направлено на изучение 
генетического потенциала сортов земляники са
довой, культивируемых в Республике Беларусь, и 
выявление сета маркеров для их идентификации.
Таблица 1
Материалы и методы
Объектом исследования служили сорта зем
ляники садовой, возделываемой в Республике 
Беларусь. Материал предоставлен РУП «Инсти
тут плодоводства» (Самохваловичи). Выделение 
тотальной ДНК из фрагмента листа отдельного 
растения осуществляли с помощью набора Ge
nomic DNA Puri�cation Kit (Thermo Scienti�c, 
Литва), согласно методике производителя. Для 
анализа полиморфизма по SSR-маркерам ис
пользовали мультиплексную ПЦР, позволяю
щую проводить реакцию одновременно для 
пар праймеров в одной микропробирке. Каж
дая пара имела специфическую флуоресцентную 
метку (FAM, R6G, TAMRA, ROX). В
исследова
нии использовали SSR-маркеры, специфичные 
для геномов 
F.
vesca
 [16] и 
F.
nubicola 
[12]. Назва
ния праймеров приведены в табл.
1. Праймеры 
синтезированы компанией Праймтех (Беларусь). 
Нуклеотидные последовательности праймеров, длина и количество аллелей SSR-локусов 
в геноме 
Локус
Последовательность 
Повторяющийся 
мотив
аллелей
Размер фрагментов, 
F GCAGTGCTACATCGACTCAGGTCCAA 
R ACCAAGGAAGTGCCGAAGTGGGTTT
TCAAATAG
F AGGTGTCCAAAGAGGGTTGCTGTAGA 
R TCCCTCTCCCAATAACCCTTTGCTTC
TAGGGA
F TGAACTGGTCCATCGGTGCTGAAA 
R TGATCACACAATACGCATTACCAAGCCT
TATG
UFFa3-D11 
F GCCTTGATGTCTCGTTGAGTAG
R TACCTTCTGCATTCACCATGAC
Молекулярная и прикладная генетика. Том 20, 2016
г.
О.А. Межнина, О.Ю. Урбанович.
 Идентификация сортов земляники садовой (
Локус
Последовательность 
Повторяющийся 
мотив
аллелей
Размер фрагментов, 
F GGAACCCCAAATACCAACTTT
R AAAGCCTGAAGTTGTTCAATAAA
F CCAGGCGCTTGGTCTTGTACTACT
R CCCATTTCCCCCAAATCTAACAAT
aAGA21F11
F CAATTCACAATGGCTGATGACGAT
R GCACTCAGACATATTTTGGGAGGG
F AGGAGAAGACCGGCTGTGTA
R TGCCTATAGCTGTGGCTGTG
F TTTTCAAATTGTTACCCCATCC
R CTAAAAATCCCCCAAATTGTGA
F GCCTCAAAGATCACTCATTTCC
R TCTTCATCTCTTTCAACCTCAAA
F GGTCACCAACAACACTCACAGATGGT
R TCATACTACCCACCACATGGGAGCAA
F GAGCCTGCTACGCTTTTCTATG
R CCTCTGATTCGATGATTTGCT
(TC)11
F GGTCCCTAAGTCCATCATGC
R GAGTGGATGCAAACATGAGC
R TTGATGGCAACAAATCACG
Состав реакционной смеси, конечным объе
мом 20
мкл, был следующий: 1×ПЦР буфер с 
(NH
SO
, 1,5
мM MgCl
2, 
200
мкМ смеси dNTP, 
по
0,2
мкМ каждого из праймеров, 20–50
нг 
ДНК и
ед. Taq-полимеразы (Thermo scienti�c, 
Литва). Реакцию ПЦР проводили по следую
щей программе: 1
цикл продолжительностью 
мин при 94
°С; 40
°циклов, включающих: 40
при 94
°С, 1
мин при 58
°С, 1
мин при 72
°С; 
заключительная элонгация
– 7
мин при 72
°С. 
Разделение фрагментов ПЦР выполняли 
на автоматическом секвенаторе 3500
Genetic 
Analyzer (Applied Biosystems, США). Раз
мер фрагментов рассчитывали с помощью 
компьютерной программы GeneMapper® 
Software
v4.1 относительно стандартных об
разцов ДНК известной длины. В качестве 
стандарта молекулярного веса использовали 
внутренний стандарт S450 (Синтол, Россия).
Дискриминационная сила маркера (PD – Power 
of Discrimination) была рассчитана по формуле:
где 
– частота встречаемости i-ого генотипа [16].
Дендрограмма генетического сходства сор-
тов земляники садовой была получена с по
мощь программы Treecon методом UPGMA, 
основываясь на коэффициенте генетического 
сходства Nei и Li [18, 19].
Результаты и обсуждение
Для анализа генетического разнообразия 
земляники садовой, выращиваемой в Респу
блике Беларусь, была сформирована коллек
ция образцов, включающая различные сорта. 
В ней представлены как сорта белорусской 
селекции, так и сорта селекции России, Герма
нии, Польши и других стран из коллекции РУП 
«Институт плодоводства», Самохваловичи.
Для оценки генетического разнообразия 
72
сортов земляники садовой было привле
чено 14
SSR-маркеров. Для каждого марке
ра определялась длина аллелей и количество 
полиморфных фрагментов у каждого сорта. 
Не
все рассматриваемые маркеры оказались 
полиморфны. Маркер EMF002 выявил толь
ко 1
аллель. Маркеры ChFaM23, EMFn017, 
FxaHGA02P13, EMFn034 и
FxaAGA21F11 не 
показали четких воспроизводимых результа
Продолжение табл. 1
Молекулярная и прикладная генетика. Том 20, 2016
г.
О.А. Межнина, О.Ю. Урбанович.
 Идентификация сортов земляники садовой (
тов. При анализе продуктов амплификации с 
данными маркерами было выявлено большее 
число аллелей, чем количество возможных 
вариантов для октоплоидных организмов. 
Вероятно, это связано с тем, что для данных 
маркеров существует несколько возможных 
сайтов связывания в геноме земляники садо
вой. Было принято решение исключить их из 
дальнейшего исследования. 
Маркеры FG7ab, FG7cd, FG2ab, UFFa3-D11, 
FG2cd, EMFvi136, EMFn121 и EMFn170 пока
зали стабильно воспроизводимые результаты. 
При этом количество аллелей, идентифици
рованных у сортов 
F.
с их помощью, 
различалось. Наименее полиморфными ока
зались маркеры FG7ab и FG2cd. Количество 
обнаруженных в них аллелей составило
7. 
помощью маркеров FG7cd и
FG2ab выяв
лено 8 и
аллелей соответственно. Маркеры 
EMFn170 и UFFa3-D11 выявили равное число 
аллелей
– 12. Максимальное количество алле
лей было выявлено в локусах, ограниченных 
маркерами EMFvi136 и EMFn121
– 16 и
15
со
ответственно (табл.
Таблица 2
Количество и длина SSR-аллелей в геноме
Маркер
Детектируемые SSR-аллели в геноме земляники садовой, п.н.
UFFa3-D11 
181, 186, 193, 196, 199, 201, 205, 207, 211, 215, 217, 219
Частота распространения аллелей в изучен
ных локусах представлена на
рис.
1. Так, в 
локусе FG7ab с наибольшей частотой встреча
лись аллели 136
п.н. (0,32), 148
п.н. (0,27). Ча
стота встречаемости других аллелей составила 
от
0,01 до 0,2. В
локусе FG7cd с одинаковой 
частотой (0,24) встречались аллели 240
п.н. и 
249
п.н., аллель 257
п.н. встречался с часто
той 0,28. Частота встречаемости остальных 
аллелей составила от 0,01 до 0,07. В
локусе 
EMFn121 с наибольшей вероятностью встре
чались аллели 239
п.н. (0,17), 249
п.н. (0,14), 
255
п.н. (0,18). Аллели 229
п.н. и 233
п.н. 
встречались с одинаковой частотой 0,1. 
Остальные аллели встречались с частотой от 
0,01 (217, 225, 237, 257
п.н.) до
0,06 (245
С помощью данного набора маркеров были 
составлены уникальные генетические пас-
порта для сортов земляники садовой, выра
щиваемой в
Беларуси. Пример генетического 
паспорта сорта Красный берег представлен 
табл.
3. Система регистрации генотипов в 
виде паспорта отражает состав аллелей в локу
сах микросателлитных последовательностей.
Таблица 3
Молекулярно-генетический паспорт земляники садовой Красный берег
Детектируемые SSR-аллели в геноме сорта земляники садовой Красный берег, п.н.
UFFa3-D11 
Молекулярная и прикладная генетика. Том 20, 2016
г.
О.А. Межнина, О.Ю. Урбанович.
 Идентификация сортов земляники садовой (
Детектируемые SSR-аллели в геноме сорта земляники садовой Красный берег, п.н.
Диаграмма распределения частот встречаемости аллелей в исследованных локусах
Продолжение табл. 3
Молекулярная и прикладная генетика. Том 20, 2016
г.
О.А. Межнина, О.Ю. Урбанович.
 Идентификация сортов земляники садовой (
В связи с тем, что земляника садовая является 
октоплоидом, при исследовании ее генома нель
зя использовать ряд показателей (например, ин
декс информативности (PIC), маркерный индекс 
(MI)), успешно применяемых для характеристи
ки диплоидных видов. Поэтому в представлен
ном исследовании каждый маркер был оценен 
с помощью такого показателя, как дискримина
ционная сила маркера (PD). Данные представ
лены в табл.
2. Значение PD, рассчитанное для 
каждого локуса, колебалось от 0,71 для локуса 
FG2cd до 0,91 для локуса EMFvi136. Среднее 
значение PD для 8
SSR-локусов составило 0,83. 
Полученное значение дискриминационной си
лы маркера свидетельствует о достаточно высо
кой разрешающей способности данного набора 
маркеров. В
общей сложности с применением 
SSR-маркеров среди 72
сортов земляники са
довой было выявлено 72
различных генотипа. 
Данные о составе аллелей, выявляемых с по
мощью 8
SSR-маркеров, были использованы 
для построения дендрограммы филогенети
ческого сходства сортов земляники садовой, 
результаты представлены на рис.
Рис. 2.
Дендрограмма генетического сходства образцов земляники, построенная на основе результатов 
SSR-анализа
Классика
Десна
Соловушка
Florens 
Чебурашка 
Купчиха
Вима Ксима
Русановка
Красный берег
Купава
Лорд
Тамара
Королева Елизавета
Кокинская поздняя
Остара
Таврическая
Росинка
Вима Занта
Орлец
Гейзер
Кармен
Фестивальная
Деснянка кокинская
Кокинская ранняя
Гигантелла 
Славяночка
Premial
Гирлянда
Данге
Славутич
Урожайная ЦГЛ
Русич
Мишутка
Витязь
Кокинская заря
Фестивальная ромашка
Eros 
Сюрприз олимпиаде
Викат
Даренка
Молекулярная и прикладная генетика. Том 20, 2016
г.
О.А. Межнина, О.Ю. Урбанович.
 Идентификация сортов земляники садовой (
Как видно из дендрограммы, сорта зем
ляники садовой генетически разнородны 
и характеризуются уникальным составом 
аллелей, выявленным отобранными SSR-
маркерами. Некоторые сорта, имеющие 
общую родословную, тесно связаны гене
тически. Например, генетическая близость 
наблюдается между сортами Elsanta и Sym
phony, в родословных которых имеется об
щий сорт Holiday. Сорта Panon и Pandora 
также генетически близки. Сорт Panon по
лучен при скрещивании Pandora × Onebor. 
На наибольшем генетическом расстоянии 
расположены сорта Pink Panda и 
Senga Sen
gana
. Сорт Pink Panda является межвидовым 
гибридом 
Fragaria chiloensis
 с 
Potentilla 
palustris
, имеет значительные морфологи
ческие отличия от остальных сортов земля
ники садовой и чаще используется в декора
тивных целях. Сорт Senga Sengana получен 
при скрещивании сортов 
Markee
× Sieger в 
1954 году на территории Германии. Сорта, 
использованные при его создании, не встре
чались в родословной взятых для исследо
вания образцов земляники садовой. Сорта 
белорусской селекции (на рис.
2 отмечены 
подчеркиванием) не образуют отдельного 
кластера и генетически тесно связаны с сор-
тами иностранной селекции. Полученные 
результаты, как и результаты исследований 
Brunings [14]
 и 
Gil-Ariza [15], показывают, 
что сорта земляники садовой, культивируе
мые в промышленных масштабах, обладают 
значительным генетическим сходством. 
Сорта культур, обладающих низким гене
тическим разнообразием, требуют большего 
количества маркеров для того, чтобы полу
чить уникальную молекулярно-генетическую 
формулу. Так, количество маркеров, необхо
димых для ДНК-типирования пшеницы мо
жет достигать 24 [20]. Для идентификации 
плодовых культур, обладающих высоким 
генетическим разнообразием, достаточно 
набора из 6–9 маркеров [10]. По рекоменда
ции Международного союза по охране новых 
сортов растений (UPOV) для генетической 
идентификации сортов земляники садовой 
предлагается использовать набор из 25 SSR-
маркеров. Данный набор маркеров при ис
следовании выборки из 100 различных сортов 
позволил выявить 98
различных генотипов 
188
аллелей, что составляет в среднем 8
ал
лелей на маркер. Такой набор маркеров может 
быть применен при проведении масштабных 
международных исследований, однако для 
практической деятельности по идентифика
ции земляники садовой данный набор слиш
ком усложнен и имеет высокую стоимость. 
исследованиях Govan (2008) при изучении 
генетического разнообразия 60
представи
телей рода 
Fragaria 
с применением 10
SSR-
маркеров было выявлено 166
аллей [13]. 
исследованиях Brunings при изучении вы
борки из 25
образцов при использовании тех 
же маркеров было обнаружено 74
аллеля 
[14]. В
данном исследовании использова
лась выборка из 72
сортов земляники садо
вой, которая при анализе по 8
SSR-маркерам 
позволила выявить 72
различных генотипа, 
86
аллелей, в среднем 11
аллелей на маркер. 
Это свидетельствует о достаточно высоком 
полиморфизме отобранных SSR-маркеров. 
Предложенный набор маркеров достаточно 
информативен и позволяет идентифициро
вать сорта земляники садовой как белорус
ской, так и иностранной селекции, выращи
ваемые на территории Беларуси.
Заключение
Молекулярное исследование геномов сор-
тов земляники садовой, выращиваемых в 
Беларуси, показало, что они характеризуют
ся невысоким генетическим разнообразием. 
SSR-анализ выявил тесную генетическую 
связь сортов селекции Беларуси, России, 
Германии, Польши и других стран. Предло
жен набор из 8
SSR-маркеров, обладающий 
достаточной степенью информативности 
для идентификации сортов земляники садо
вой отечественной и зарубежной селекции, 
выращиваемых в Беларуси. Анализ локусов 
микросателлитных последовательностей, вы
являемых с помощью выбранных маркеров, 
позволил выявить 72 различных генотипа 
среди 72 сортов земляники садовой. 
Авторы выражают благодарность руко
водителю отдела ягодных культур Михай
ловой Алле Михайловне (РУП «Институт 
плодоводства», Самохваловичи) за предо
ставленный сортовой материал земляники 
садовой.
Молекулярная и прикладная генетика. Том 20, 2016
г.
О.А. Межнина, О.Ю. Урбанович.
 Идентификация сортов земляники садовой (
Список использованных источников
11.
Sargent, D. Developmentand characteri
sation of polymorphic microsatellite markers 
from Fragaria viridis, a wild diploid straw
berry / D.
Sargent, A.
Hadonou, D.
Simpson 
// Mol Ecol Notes.
– 2003.
– Vol.
3, №
4.
P.
550–552.
A genetic linkage map of microsatellite, 
gene-speci�c and morphological markers in dip
Fragaria / D.
Sargent [et
al.] // Theor Appl 
– 2004.
– Vol.
109, №
– P.
13.
A reliable multiplexed microsatellite set 
for genotyping Fragaria and its use in a sur
vey of 60
F.
× ananassa cultivars / C.
Govan 
[et
al.] // Mol Breed.
– 2008.
– Vol.
22, №
4.
P.
649–661.
Implementation of simple sequence repeat 
markers to genotype Florida strawberry varieties 
/ A.M.
Brunings [et
al.] // Euphytica.
– 2010.
Vol.
– P.
Impact of plant breeding on the genetic 
diversity of cultivated strawberry as revealed 
by expressed sequence tag-derived simple se
quence repeat markers / D.J.
Gil-Ariza [et
al.] // 
Am Soc Hortic Sci.
– 2009.
– Vol.
134, №
P.
A genome-enabled, high-throughput, and 
multiplexed �ngerprinting platform for straw
berry (Fragaria
L.) / A.
Chambers [et
al.] // 
– Vol.
– P.
PCR-ampli�cation and detection of the 
human DIS80 VNTR locus. Ampli�cation con
dition, population genetics and application in fo
rensic analysis / A.D.
Kloosterman, B.
P.
Daselaar // Int. J.
Leg. Med.
– 1993.
– Vol.
Nei, M. Mathematical model for studying 
genetic variation in terms of restriction endo
nucleases / M.
Nei, W.H.
Li // Proc. Natl. Acad. 
– Vol.
– P.
Van de Peer, Y. TREECON: a software 
package for the construction and drawing of evo
lutionary trees / Y.
Van
Peer, R.
Wachter 
// Comput. Applic. Biosci.
– 1993.
– Vol.
P.
20.
Assesing genetic diversity of wheat 
Triticum aestivum
L.) germplasm using mi
crosatellite markers / X.Q.
Huang [et
al.] // 
Theor Appl Genet.
– 2002.
– Vol.
105, №
5.
P.
699–707.
G. Strawberry biogeography, ge
netics and systematics / G.
Staudt // Acta Hort.
– Vol.
– P.
Hummer, K.E. Strawberry genomics: bo
tanical history, cultivavtion, traditional breeding 
and new techonologies / K.E.
Hummer, J.
cock // Genetics and genomics of
– P.
Akiyama, Y. Estimation of the nuclear 
DNA content of strawberries (Fragaria spp.) 
compared with
Arabidopsis thaliana
by using 
dual system �ow cytometry / Y.
Akiyama [et
– Vol.
– P.
DNA �ngerprinting of strawberry (Fraga-
ria × ananassa) cultivars using randomly ampli
�ed polymorphic DNA (RAPD) markers / C.
gani [et
al.] // Euphytica.
– 1998.
– Vol.
– P.
Morphological traits and high resolu
tion RAPD markers for the identi�cation of the 
main strawberry varieties cultivated in Argen
tina / M.
Garcia [et
al.] // Plant Breed.
– 2002.
Vol.
– P.
Hancock, J. Randomly ampli�ed poly
morphic DNAs in the cultivated strawberry 
Fragaria×ananassa / J.
Hancock, P.
Callow, 
D.V.
Shaw // J
Am Soc Hortic Sci.
– 1994.
Vol.
119, №
– P.
Characterization of mixed disomic and 
polysomic inheritance in the octoploid straw
berry (Fragaria × ananassa) using AFLP map
ping / E.
Lerceteau-Köhler [et
al.] // Theor Appl 
– Vol.
– P.
Arnau, G. Fast and reliable strawberry cul
tivar identi�cation using inter simple sequence 
repeat (ISSR) ampli�cation / G.
Arnau, J.
lemand, M.
Bourgoin // Euphytica.
– 2002.
Vol.
– P.
 The use of random ampli�ed polymorphic 
DNA (RAPD) markers to identify strawberry va
rieties: a forensic 
application / 
// Mol Ecol.
– 2000.
– Vol.
9, №
– P.
Урбанович, О.Ю. Молекулярные 
маркеры идентификации и генотипирования 
яблони и груши: метод. рекомендации / О.Ю. 
Урбанович; Институт генетики и цитологии 
НАН Беларуси.
– Минск: Право и экономика, 
Молекулярная и прикладная генетика. Том 20, 2016
г.
О.А. Межнина, О.Ю. Урбанович.
 Идентификация сортов земляники садовой (
. Mezhnina, O.Yu. 
CAT
AN
Institute of Genetics and Cytology of the National Academy of Sciences of Belarus
Minsk BY-220072, Republic of Belarus
For the successful implementation of breeding programs the identi�cation of genotypes as cultivars, as hybrids and 
original forms has a great importance. Varieties of strawberry have signi�cant phenotypic similarity which complicates 
their identi�cation by phenotypic characteristics. Thereby it is increasingly important to develop ef�cient and reliable 
Molecular study of strawberry varieties genomes grown in Belarus showed that they are characterized by low genetic 
diversity. SSR-analysis showed a close genetic relationship of studied varieties in Belarus, Russia, Germany, Poland and 
other countries. We suggest the set of 8 SSR markers with suf�cient degree of informative value for the identi�cation 
of domestic and foreign selection strawberry varieties grown in Belarus. The analysis of 8 microsatellite sequences 
allowed identifying 72 different genotypes, 86 alleles, with an average of 11 alleles per marker.
strawberry, genetic diversity, SSR markers, DNA-typing.
Дата поступления статьи 10 февраля 2016 г.
Молекулярная и прикладная генетика. Том 20, 2016
г.
УДК 575.174.015.3:577.24
Н.В. Савина, Н.В. Никитченко, Т.Д. Кужир, Р.И. Гончарова 
ОЛИМОРФИЗМ
КОДИРУЮ
ГЕЛИКАЗЫ
ВЛИЯНИЕ
ПРОДОЛ
ИТЕЛЬНОСТЬ
Институт генетики и цитологии НАН Беларуси
Республика Беларусь, 220072, г. Минск, ул. Академическая, 27; e-mail: [email protected]
Изучено влияние гомозиготности по аллелям дикого типа в полиморфных локусах генов, кодирующих XPD- и 
CSB-геликазы, на продолжительность жизни. С этой целью проанализирован полиморфизм генов 
ERCC2/XPD
Asp312Asn и Lys751Gln, 
 Met1097Val и Gly399Asp у 354
клинически здоровых жителей Беларуси 
от 31 до 94
лет. Обнаружено повышение с возрастом частоты гомозигот дикого типа 
 Asp312Asp 
и Lys751Lys, а также их комбинаций, которое особенно ярко проявлялось в группе старше 80
лет. Показано 
возрастание гомозиготности по аллелям дикого типа всех изученных локусов после 60
лет, что указывает на 
связь продолжительности жизни и долголетия с нормальным функционированием этих генов и их продуктов. 
При учете статуса курения общие закономерности в большей степени проявлялись в группе некурящих лиц.
Ключевые слова:
 ДНК-геликазы, репарация ДНК, окислительный стресс, продолжительность жизни.
Введение
ДНК подвергается постоянным атакам эк
зогенных и эндогенных генотоксикантов, что 
ежедневно приводит к образованию не менее 
200
000 модификаций [1, 2]. Часть из них, оста
ваясь нерепарированной, трансформируется в 
мутации и перестройки хромосом, дестабили
зирует геном и вносит вклад в старение клеток 
[3, 4]. Репарация ДНК поддерживает целост
ность и стабильность генома и обеспечивает 
выживаемость и устойчивость клеток к стрес
совым воздействиям. На начальных этапах 
этого процесса важную функцию выполняют 
ДНК-геликазы, которые раскручивают двойную 
спираль ДНК, переводя ее в одноцепочечное 
состояние и открывая доступ к поврежденно
му сайту другим компонентам репарационной 
машины. Кроме того, ДНК-геликазы необхо
димы для метаболизма ДНК и РНК, участвуют 
в других матричных процессах (репликации, 
рекомбинации, транскрипции), обеспечивая 
их полноценность и точность [5, 6]. Имеет
ся два суперсемейства геликаз (SF1 и SF2). К 
SF2 принадлежат ДНК-геликазы, инактивация 
которых наблюдается при генетически детер
минированных синдромах преждевременного 
старения (Вернера, Блюма) или сегментарных 
прогериях [7]. В
рамках данного исследования 
нас интересовали гены 
ERCC2/XPD
 и 
ERCC6/
CSB
, мутации в которых вызывают пигментную 
ксеродерму и синдром Коккейна [8]. Известно, 
что синдром Коккейна отличается признаками 
ускоренного старения [9], тогда как пигментная 
ксеродерма характеризуется высоким риском 
канцерогенеза с преимущественным поражени
ем глаз и кожи [10]. Тем не менее, обе болезни 
относятся к сегментарным прогериям [11] и 
манифестируют симптомы, перекрывающиеся 
с патологией старческого возраста [12]. 
Продукты этих генов (протеины XPD и CSB) 
обладают геликазной активностью и участву
ют в эксцизионной репарации нуклеотидов 
(NER): глобальной и связанной с транскрип
цией. Кроме основных функций, показано их 
взаимодействие с компонентами эксцизионной 
репарации оснований (BER) [13] и способ
ность удалять повреждения, индуцированные 
окислительным стрессом [14, 15], который 
вносит существенный вклад в старение. Все 
перечисленное делает обоснованным изучение 
влияния на продолжительность жизни функ
ционирования этих генов у гомозиготных но
сителей аллелей дикого типа. Эта проблема в 
связи с эксцизионной репарацией ДНК затра
гивалась нами в предыдущих публикациях [16, 
17]. В данной работе представлены результаты 
более детального исследования полиморфиз
ма генов, ответственных за ДНК-геликазы, на 
репрезентативной выборке жителей Беларуси 
среднего, пожилого и старческого возраста. 
Молекулярная и прикладная генетика. Том 20, 2016
г.
Н.В. Савина и др. 
Полиморфизм генов, кодирующих ДНК-геликазы влияние на продолжительность жизни
Результаты и обсуждение
Материалы и методы
Влияние полиморфизма генов ERCC2/XPD 
ERCC6/SCB на продолжительность жизни
В этом исследовании использованы образцы 
ДНК от клинически здоровых лиц в возрас
те от 31 года до 94
лет. Проанализирован по
лиморфизм генов эксцизионной репарации 
ERCC2/XPD 
в кодонах 312 и 751 и 
ERCC6/
CSB
– в кодонах 1097 и 399 в зависимости от 
возраста обследуемых. Данные по полимор
физму этих генов во всей популяции и под
группах, альтернативных по возрасту, пред
ставлены в табл.
1. 
Благодаря этому сравнению, установлены 
статистически значимые различия по распре
делению вариантов гена 
ERCC6
 Gly399Asp. 
При этом частота аллеля дикого типа увели
чивалась в подгруппе лиц старше 80
лет отно
сительно среднего возраста, тогда как частота 
минорного аллеля 
ERCC6
 399Asp уменьша
лась. Других статистически подтвержденных 
различий между группами не обнаружено. 
Следует отметить, что этот подход имеет 
некоторые ограничения. Сопоставление ре
зультатов генотипирования в альтернативных 
по возрасту группах необязательно выявит су
щественные различия между ними, поскольку 
среди людей среднего возраста могут оказать
ся в будущем как долгожители, так и не дожив
шие до глубокой старости. Более информатив
ным представляется корреляционный анализ, 
позволяющий проследить за изменениями в 
распределении генотипов по отдельным генам 
и их комбинациям в зависимости от возраста в 
группах пожилых людей (после 60
лет) и стар
ческого возраста (после 80
лет) по сравнению 
со всей обследованной популяцией. 
Корреляционный анализ выявил тенденцию 
к повышению с возрастом частоты встречае
мости гомозигот дикого типа по гену 
Gly399Asp (rs2228528) у клинически здоро
вых лиц от 40 до 94
 0,25 при 
 0,077. 
Гомозиготы дикого типа по другому локусу 
ERCC6
 Met1097Val (rs2228526) встречались 
примерно с одинаковой частотой у лиц разно
го возраста, что в принципе соответствовало 
данным табл.
Статистически подтверждена зависимость 
от возраста частоты встречаемости гомози
гот дикого типа по отдельным полиморф
ным локусам гена 
 (rs1799793 и rs13181) 
Группа обследования
состояла из 354
кли
нически здоровых жителей Беларуси. В
нее 
вошли здоровые индивидуумы, принимав
шие участие в донорстве крови в РНПЦ 
трансфузиологии и медицинских биотехно
логий (Минск), и люди пожилого возраста, 
наблюдающиеся на кафедре геронтологии и 
гериатрии БелМАПО. Основным условием 
для отбора участников исследования явля
лось отсутствие в анамнезе онкологической 
патологии и острых заболеваний либо хро
нических в стадии обострения. Забор био
логического материала (периферической 
венозной крови) проводился сотрудниками 
медицинских учреждений после подписания 
волонтерами информированного согласия. 
Всем участникам гарантировалась конфи
денциальность сведений личного характера. 
Стерильно взятые образцы цельной крови в 
количестве 3–5
мл хранились в вакутайне
рах с распыленным ЭДТА при температуре 
–20
°С до начала молекулярно-генетических 
исследований.
Объект исследования
– геномная ДНК, вы
деленная из образцов цельной венозной крови 
стандартным фенол-хлороформным методом. 
Анализ полиморфизма генов репарации ДНК
ERCC2
XPD
 (rs1799793, rs13181) и 
ERCC6/
CSB
 (rs2228526, rs2228528) проводили с по
мощью полимеразной цепной реакции с опре
делением длин рестрикционных фрагментов 
(ПЦР-ПДРФ-метод). Праймеры, условия ПЦР, 
рестрикционные эндонуклеазы и фрагменты 
ДНК, соответствующие определенным гено
типам, подробно описаны ранее [18, 19].
Для статистической обработки данных
использован пакет стандартных программ 
Excel
2000 и
Statistica
6. Существенные раз
личия в частотах тех или иных генотипов/
аллелей, так
же как и других альтернатив
ных показателей, подтверждали с помощью 
критерия χ
, тогда как различия по количе
ственным признакам определяли по крите
рию
 Стьюдента. Для установления связи 
между параметрами применяли корреляци
онный анализ, для чего вычисляли средние 
частоты комбинаций гомозигот дикого типа 
для каждого возраста всей исследованной 
популяции или внутри подгрупп старше 60, 
70 и
80
лет.
Молекулярная и прикладная генетика. Том 20, 2016
г.
Н.В. Савина и др. 
Полиморфизм генов, кодирующих ДНК-геликазы влияние на продолжительность жизни
в популяции, включающей клинически здо
ровых индивидуумов от 40 до 94
 0,47 
 0,0005 для генотипа 
 Asp312Asp 
 0,40 при 
 0,0036
– для генотипа 
Lys751Lys. Коэффициенты корреляции увели
чивались в подгруппе старше 80
лет (
 0,65 
 0,016 и 
 0,62 при 
 0,024, соот
ветственно), указывая на достаточно сильную 
связь между этими параметрами у людей стар
ческого возраста и долгожителей.
Таблица 1 
Распределение аллельных вариантов генов 
 в исследованной 
популяции жителей Беларуси
Генотипы/аллели
Вся популяция
Альтернативные по возрасту группы
31–94 г.: n (%)
80–94 года: n, (%)
Lys/ Lys
Lys/Gln
Lys
Met1097Val 
Met/Val
Val/Val
Val
11,5
Примечание. Статистически значимые различия между альтернативными группами при 
Представлял интерес анализ распределе
ния по возрасту комбинаций аллелей дикого 
типа в гомозиготном состоянии. Рис.
1 де
монстрирует корреляцию между частотой 
встречаемости таких комбинаций по гену 
ERCC2/XPD
 и возрастом обследованных 
лиц старше 40
лет (
 0,40 при 
 0,0036). 
Эта зависимость существенно усиливалась 
после 80
лет (
 0,62 при 
 0,027). Кор
реляция между частотами комбинаций го
Молекулярная и прикладная генетика. Том 20, 2016
г.
Н.В. Савина и др. 
Полиморфизм генов, кодирующих ДНК-геликазы влияние на продолжительность жизни
мозигот дикого типа по гену 
ERCC6/CSB
 и 
возрастом обследованных отсутствовала. 
Однако частоты комбинаций гомозигот ди
кого типа по всем исследованным локусам 
повышались с увеличением возраста, корре
ляция между этими параметрами станови
лась статистически значимой после 60
лет 
(рис.
2).
Таким образом, применение двух подходов, 
а именно сравнения распределения геноти
пов в альтернативных по возрасту группах 
(31–50
лет и
80–94
года) и корреляционно
го анализа взаимосвязи с возрастом частоты 
гомозигот по аллелям дикого типа, выявило 
следующие закономерности:
Рис. 1.
 Взаимосвязь между частотами встречаемости комбинированных гомозигот дикого типа по двум кодонам 
гена 
 и возрастом клинически здоровых лиц: а
– в группе от 40
– в подгруппе старше 80
Рис. 2.
 Взаимосвязь между частотами встречаемости комплекса гомозигот дикого типа у клинически здоровых 
лиц старше 60
1)
Наблюдались существенные различия 
между альтернативными по возрасту группа
ми по гену 
2)
Корреляционный анализ показал суще
ственное повышение с возрастом частоты 
гомозигот дикого типа 
 312 Asp/
Asp и 
ERCC2/XPD
 751 Lys/Lys, которое на
блюдалось во всей исследованной популяции, 
начиная с 40
лет, но особенно заметно
– в груп
пе старческого возраста. Гомозиготность по 
нормальным аллелям всех изученных локусов 
увеличивалась с возрастом в группе лиц стар
ше 60
лет. Показательно, что этот комплексный 
генотип выявлен у единственного 94-летнего 
долгожителя.
Молекулярная и прикладная генетика. Том 20, 2016
г.
Н.В. Савина и др. 
Полиморфизм генов, кодирующих ДНК-геликазы влияние на продолжительность жизни
Представленные результаты согласуются 
с ранее опубликованными данными относи
тельно взаимодействия генов эксцизионной 
Участие XPD- и CSB-геликаз в эксцизион
ной репарации нуклеотидов [9, 20], которая 
элиминирует различные типы поврежде
ний ДНК, накапливающиеся с возрастом, 
предполагает их возможное влияние на 
продолжительность жизни. Недавние ис
следования на культурах клеток человека 
и млекопитающих продемонстрировали 
непосредственное взаимодействие ряда по
добных ферментов с повреждениями в раз
личных ядерных компартментах при окис
лительном стрессе [14, 15]. Установлено 
также, что CSB-геликаза может выступать 
в роли ловушки свободных радикалов, и 
ее дисфункция в митохондриях приводит 
к усилению окислительного стресса [21], а 
XPD-протеин, локализованный в мембра
не митохондрий, обеспечивает стабиль
ность митохондриального генома, повышая 
эффективность репарации повреждений, 
индуцированных активными формами 
кислорода [22]. Учитывая перечисленные 
функции ДНК-геликаз, а также существен
ный вклад повреждений ДНК и окислитель
ного стресса в старение, можно ожидать, 
что их оптимальная активность в течение 
всей жизни будет способствовать долголе
тию. Наши данные подтверждают эту идею.
Зависимость распределения гомозигот по 
аллелям дикого типа от курения
 представля
ла отдельный интерес, так как известен вклад 
этой вредной привычки в развитие различных 
патологий, в том числе болезни пожилого воз
раста. Табачный дым, частично через индук
цию активных форм кислорода, способствует 
развитию атеросклероза коронарных сосудов, 
диабета II
типа и злокачественных новооб
разований [23]. Так, курение является одним 
из важнейших этиологических факторов рака 
мочевого пузыря, который ассоциирован со 
старением [24]. 
Как следует из табл.
2, в исследовании при
нимали участие клинически здоровые взрос
лые индивидуумы с достаточно большой долей 
представителей пожилого и старого населения. 
Среди них 99
человек (28%) курит, 229
человек 
(64,7%) не курит. В
26
анкетах (7,3%) не указан 
статус курения. Процентное соотношение ку
рящих и некурящих лиц в исследованной попу
ляции в целом отражало картину потребления 
табака в Беларуси, так как по данным Мини
стерства здравоохранения в последние годы этот 
показатель колебался в пределах 32,3–42,3%. 
Эти сведения сходны с данными глобального 
опроса взрослого населения о потреблении та
бака в России (39,1% курящих и 60,9% некуря
щих) [25]. Небольшие различия с официальны
ми данными в сторону уменьшения процента 
курящих в нашей выборке можно объяснить 
отсутствием в ней лиц молодого возраста. 
Таблица 2
Характеристика исследованной популяции по возрасту в зависимости от статуса курения 
Курящие (n
Некурящие (n
Средний (Mean ± SD)
Медианный
Минимальный
Максимальный
Количество, %
57 (25,11)
Примечание. Статистическая значимость различий между группами по среднему возрасту определена в соответствии с 
двухсторонним критерием 
 Стьюдента, тогда как распределения по возрастным группам сравнивались по критерию χ
Молекулярная и прикладная генетика. Том 20, 2016
г.
Н.В. Савина и др. 
Полиморфизм генов, кодирующих ДНК-геликазы влияние на продолжительность жизни
Анализ исследованной популяции по возра
сту в связи со статусом курения выявил, что 
средний возраст курящих оказался на 11
меньше, чем у некурящих лиц; медианный 
возраст также значительно различался в этих 
группах, хотя показатели минимального и мак
симального возраста были достаточно близки. 
В наиболее многочисленную группу курящих 
вошли лица от 51 до 60
лет, тогда как среди 
некурящих лица этого возраста, а также от 
71 до 80 и старше 80
лет составили примерно 
одинаковые группы (от 25 до 30% выборки). 
Только группа от 61 до 70
лет была представ
лена равными долями среди курильщиков и 
лиц без этой вредной привычки. Видно, что с 
возрастом (старше 60
лет) количество курящих 
резко сокращается.
Поскольку в предыдущей части работы наи
более четкие зависимости касались комбина
ций гомозигот дикого типа гена 
ERCC2/XPD
(кодоны 312 и 751) и комплекса генов 
XPD
 312_751 и 
ER
СС6
/CSB
 1097_399, их ча
стоты проанализированы в связи с курением. 
Из данных табл.
3 вытекает, что гомозиготный 
генотип 
XPD
 Asp312Asp (в отличие от 
XPD
Lys751Lys) существенно чаще встречается 
среди некурящих; такая же ассоциация свой
ственна комбинации нормальных генотипов 
при парном взаимодействии 
XPD
 Asp312Asp 
и 
XPD
 Lys751Lys, что, по-видимому, обу
словлено доминирующим влиянием первого 
генотипа. 
В связи с этим следует упомянуть резуль
таты изучения эффектов полиморфизма не
которых генов эксцизионной репарации ДНК 
на формирование привычки к курению [17, 
18]. Из четырех изученных генов тесную ас
социацию со статусом курильщика продемон
стрировал только аллель 
XPD 
312Asn. Частота 
Таблица 3
гомозиготных носителей аллелей дикого типа 
этого гена была существенно выше среди не
курящих лиц. 
В данной работе комбинация гомозиготных 
аллелей дикого типа по всем проанализиро
ванным локусам оказалась нейтральной по 
отношению к курению.
Далее изучено распределение гомозигот ди
кого типа в зависимости от возраста курящих и 
некурящих лиц. Следует сразу подчеркнуть, что 
результаты корреляционного анализа в группе 
некурящих лиц, как правило, повторяли общие 
закономерности: частота гомозиготных аллелей 
дикого типа по паре 
ERCC2/XPD
 312_751 суще
ственно увеличивалась в этой группе, начиная 
с 40
лет (
 0,37 
 0,012), но особенно
– в 
старческом возрасте (
 0,61 
 0,035), а ча
стота комплекса гомозигот по всем изученным 
вариантам повышалась не только в пожилом 
возрасте (после 70
лет), но и во всей обследо
ванной популяции жителей Беларуси без этой 
вредной привычки (38
лет
– 94
года) (рис.
3 а, б). 
В группе курящих выявлялись те же тен
денции: частота гомозигот дикого типа 
XPD
Asp312Asp и 
 Lys751Lys коррелировала с 
возрастом в подгруппе старше 70
лет (
 0,56 
 0,058 и 
 0,50 при 
 0,098, соот
ветственно). При их взаимодействии между 
собой коэффициент корреляции после 70
становился высоко значимым (
 0,55 при 
0,015). Наличие среди курящих всего 5
носите
лей комплекса гомозигот дикого типа по четы
рем локусам не позволяло проанализировать 
их распределение по возрасту.
Некоторые различия между группами не
курящих и курящих лиц по распределению 
гомозиготных носителей аллелей дикого ти
па могут быть связаны с почти трехкратным 
повышением доли людей более преклонного 
Гомозиготность по аллелям дикого типа генов
Гомозиготные носители аллелей дикого типа
Курящие
Некурящие
Количество
Количество
 Asp312Asp
 Lys751Lys
Примечание. Статистически значимые различия установлены с помощью критерия χ
Молекулярная и прикладная генетика. Том 20, 2016
г.
Н.В. Савина и др. 
Полиморфизм генов, кодирующих ДНК-геликазы влияние на продолжительность жизни
возраста (61–94 года) среди первых по сравне
нию со вторыми (62% и 21%, соответственно; 
< 0,00001). Отсюда следует, что курение яв
ляется независимым фактором, сокращающим 
продолжительность жизни. С другой стороны, 
генотипы, обеспечивающие нормальное функ
ционирование ДНК-геликаз, особенно XPD-
протеина, способствуют увеличению продол
жительности жизни в обеих группах, что может 
указывать на независимый характер их влияния 
на процесс старения и долголетия. Однако, что 
касается гена 
XPD
 (кодон
312), по-видимому, 
нельзя пренебрегать данными о вкладе поли
морфизма этого гена в формирование привычки 
к курению (в данном случае, о повышении ча
стоты гомозигот дикого типа среди некурящих 
лиц) [17]. Вероятно, самостоятельное положи
тельное влияние гомозиготности по аллелю 
дикого типа этого гена на продолжительность 
жизни может усиливаться благодаря его защит
ному эффекту против склонности к курению. 
си среднего, пожилого и старческого возраста 
установлены статистически значимые различия 
по распределению генотипов полиморфного ло
куса 
ERCC6/CSB
Gly399Asp в альтернативных 
по возрасту группах с увеличением частоты 
носителей аллеля дикого типа среди индиви
дуумов старше 80
лет. Корреляционный анализ 
показал зависимое от возраста накопление го
мозиготных генотипов 
ERCC2/XPD
 Asp312Asp 
и Lys751Lys, их комбинаций, а также комплекс
ных гомозиготных генотипов, содержащих нор
мальные аллели по всем изученным полиморф
ным локусам, что особенно ярко проявлялось в 
пожилом и старческом возрасте. При изучении 
распределения гомозигот дикого типа с уче
том статуса курения общие закономерности, 
касающиеся полиморфизма гена 
ERCC2/XPD
проявлялись как в группах некурящих, так и 
курящих лиц, тогда как частота носителей ком
плексного гомозиготного генотипа по четырем 
изученным локусам существенно повышалась 
с возрастом в группе некурящих лиц, особен
но после 70
лет. Анализ всех данных позволил 
выявить влияние гомозиготности по аллелям 
дикого типа с доминирующим эффектом гена 
XPD
 на продолжительность жизни, что может 
рассматриваться и как самостоятельный генети
ческий фактор, способствующий долголетию, 
и в связи с курением.
Авторы искренне благодарят доцента ка
федры терапии Белорусской медицинской 
академии последипломного образования к.м.н. 
В.Э. Сушинского за помощь в организации сбо
ра образцов биологического материала. 
Рис. 3.
 Распределение комплекса гомозигот по аллелям дикого типа изученных генов: а
– во всей популяции 
некурящих лиц; б
– в подгруппе старше 70-ти
Заключение
ДНК-геликазы XPD и CSB вносят существен
ный вклад в репарацию различных (включая 
индуцированные активными формами кис
лорода) повреждений ДНК, а подавление их 
активности приводит к развитию наследствен
ных заболеваний (пигментной ксеродермы и 
синдрома Коккейна), в той или иной степени 
проявляющих прогероидные признаки. На этом 
основании изучено влияние полиморфизма со
ответствующих генов (
ERCC2/XPD
 и 
ERCC6/
CSB
) на продолжительность жизни. На выборке 
из 354 клинически здоровых жителей Белару
Молекулярная и прикладная генетика. Том 20, 2016
г.
Н.В. Савина и др. 
Полиморфизм генов, кодирующих ДНК-геликазы влияние на продолжительность жизни
Список использованных источников
meulen // J. Cell Biol.
– 2012.
– Vol.
199, №
P.
15.
The cross talk between pathways in the re
pair of 8-oxo-7,8-dihydroguanine in mouse and 
human cells / E.
Parlanti [et
al.] // Free Radic. Biol. 
Med.
– 2012.
– Vol. 53, №
11.
– P.
2171–2177. 
Полиморфизм генов эксцизионной репа-
 и 
 у населения 
Республики Беларусь и его влияние на канце-
рогенез / О.П.
Романюк [и
др.] // Экологическая 
генетика.
– Т.
11, №4.
Связь полиморфизма генов репарации 
XPD, XRCC1, OGG1, ERCC6
 с 
продолжительностью жизни и склонностью к 
курению / О.П.
Романюк [и
др.] // Генетика.
– Т.
1–11.
Polymorphism of DNA repair genes 
OGG1, XRCC1, XPD
, and 
in bladder 
cancer in Belarus / V.P.
Ramaniuk [et
al.] // Bio
– Vol.
– P.
The cellular response to oxidatively in
duced DNA damage and polymorphism of some 
DNA repair genes associated with clinicopatho
logical features of bladder cancer / N.V.
al.] // Oxidative Medicine and Cellular Lon
gevity.
TFIIH, XPD
 helicase is exclusively de
voted to DNA repair / J.
Kuper [et
al.] // PLoS 
– Vol.
21.
Mitochondrial reactive oxygen species are 
scavenged by Cockayne syndrome B protein in 
human �broblasts without nuclear DNA damage / 
J.E.
Cleaver [et
al.] // Proc. Natl. Acad. Sci. USA.
2014.
– Vol.
111, №
37.
– P.
13
487–13
492. 
 localizes in mitochondria and pro
tects the mitochondrial genome from oxidative 
DNA damage / J.
Liu [et
al.] // Nucleic Acids 
– Vol. 43, №
11.
– P.
23.
Reactive oxygen species, nutrition, hypoxia 
and diseases: Problems solved? / A.
Görlach [et
al.] 
// Redox Biol.

2015.

Vol. 6.

P.
372–385.
Gene polymorphisms in bladder cancer / 
Franekova [et al.] // Urol. Oncol.
– 2008.
Vol. 26.
– P.
Глобальный опрос взрослого населения 
о потреблении табака (GATS): Российская 
Федерация // Всемирная организация 
здравоохранения [Электронный ресурс]. – 
– 171
– Режим доступа: http://www.
who.int/tobacco/surveillance/ru_tfi_gatsrus
Billen, D. Spontaneous DNA damage and 
its signi�cance for the “negligible dose” contro
versy in radiation protection / D.
Billen // Radiat 
– Vol.
– P.
2.
Ciccia, A. The DNA damage response: mak
ing it safe to play with knives / A.
Ciccia, S.J.
Elledge 
// Molecular Cell.
– 2010.
– Vol.
40.
– P.
179–204.
Campisi, J. Cancer, aging and cellu
lar senescence / J. Campisi // In Vivo. 2000.
Vol.
– P. 183–188. 
Hanahan, D. Hallmarks of cancer: the 
next generation / D.
Hanahan, R.A.
Weinberg // 
– 2011.
– Vol.
– P.
5.
Lohman, T.M. Non-hexameric DNA heli
cases and translocases: mechanisms and regulation 
/ T.M.
Lohman, E.J.
Tomko, C.G.
Wu // Nat. Rev. 
Mol. Cell Biol.
– 2008.
– Vol.
9.
– P.
391–401.
Fairman-Williams, M.E. SF1 and SF2 he
licases: family matters / M.E.
Fairman-Williams, 
U.P.
Guenther, E.
Jankowsky // Curr. Opin. 
– Vol.
– P.
Byrd, A.K. Superfamily 2 helicases / 
Byrd, K.D.
Raney // Front Biosci. (Land
– Vol.
– P.
8.
Lehmann, A.R. DNA repair-de�cient diseas
es, xeroderma pigmentosum, Cockayne syndrome 
and trichothiodystrophy / A.R.
Lehmann // Biochi
mie.
– 2003.
– Vol.
85, №
11.
– P.
1101–1111.
Andressoo, J.O. Nucleotide excision re
pair disorders and the balance between cancer 
and aging / J.O.
Andressoo, J
Mitchell // Cell Cycle.
– 2006.
– Vol.
– P.
10.
Xeroderma pigmentosum: a case report and 
review of the literature / L.J.
Feller [et
al.] // Prev. 
Med. Hyg. –2010.
– Vol.
51, № 2.
– P.
87–91.
11.
Xeroderma pigmentosum and other diseases of 
human premature aging and DNA repair: molecules 
to patients / L.J.
Niedernhofer [et al.] // Mech Ageing 
Dev.
– 2011.
– Vol.
132, №
6–7.
– P.
340–347.
Coppedè, F. DNA repair in premature aging 
disorders and neurodegeneration / F.
Migliore // Curr Aging Sci.
– 2010.
– Vol.
– P.
Kuper, J. DNA helicases in NER, BER, 
and MMR / J.
Kuper, C.
Kisker // Adv. Exp. 
– Vol.
– P.
Menoni, H. Nucleotide excision repair-
initiating proteins bind to oxidative DNA lesions 
in vivo / H.
Menoni, J.H.
Hoeijmakers, W.
Ver
Молекулярная и прикладная генетика. Том 20, 2016
г.
Н.В. Савина и др. 
Полиморфизм генов, кодирующих ДНК-геликазы влияние на продолжительность жизни
.V. 
.V. 
.D. Kuzhir, 
.I. Goncharova
ACT 
Institute of Genetics and Cytology of the National Academy of Sciences of Belarus
Minsk BY-220072, Republic of Belarus
Impact of homozygosity by wild type alleles in the polymorphic loci of genes coding XPD and CSB helicases on 
lifespan was studied. For this purpose, polymorphisms of 
ERCC2/XPD 
Asp312Asn and Lys751Gln, 
ERCC6/CSB 
Met1097Val and Gly399Asp were analyzed in 354 clinically healthy residents of Belarus aged from 31 to 94 years. 
Age-dependent increase in the frequency of 
ERCC2/XPD
 Asp312Asp and Lys751Lys genotypes, as well as their 
combination, was found, especially in the group over 80 years. Homozygosity by wild type alleles in all studied loci was 
enhanced in individuals over 60 years that indicated association of lifespan and longevity with normal functioning of 
these genes and their products. Taking into account the smoking status, the common peculiarities were rather observed 
DNA helicases, DNA repair, oxidative stress, lifespan.
Дата поступления статьи 8 декабря 2015 г.
Молекулярная и прикладная генетика. Том 20, 2016
г.
УДК 577.21; 575.162
Е.А. Аксенова
, Н.А. Мартусевич
ергейчик
, Н.П. Митьковская
АСТОТА
АЛЛЕЛЕЙ
ПАЦИЕНТОВ
ВАРИАНТОМ
РЕВМАТОИДНОГО
АРТРИТА
РОДСТВЕННИКОВ
РОДСТВА
Институт генетики и цитологии НАН Беларуси
Республика Беларусь, 220072, г. Минск, ул. Академическая, 27; e-mail: [email protected]
Белорусский государственный медицинский университет
Республика Беларусь, 220116, г. Минск, пр-т Дзержинского, 83
Исследование генотипов 
51 пациента с АЦЦП-позитивным ревматоидным артритом (РА) пока
зало, что 68,6% имели аллели общего эпитопа SE, обеспечивающие высокое сродство DRβ1 цепи ГКГС к ци
труллинированным пептидам. Наиболее частым в изученной выборке (19,61%) был SE-аллель DRB1*04:01:01, 
следующим по распространенности (
15,69%
) определен нейтральный аллель DRB1*15:01:01 и с частотой 
13,73% выявлен SE-аллель DRB1*01:01:01. 15,7% пациентов имели в своем генотипе два SE-аллеля, причем 
три человека были гомозиготными по аллелю DRB1*04:01:01. В 31,3% случаев РА встречались генотипы SE/
XP4n, сочетающие аллель общего эпитопа и «протективный». Среди 61 родственника пациентов у 4,9% обна
ружены SE/SE-генотипы и у большинства (29,5%) – SE/XP4n-генотипы. Достоверных различий между груп
пами пациентов и родственников по частоте генотипов и аллелей не выявлено.
Ключевые слова:
 ревматоидный артрит, 
, АЦЦП, общий эпитоп.
Введение
Ревматоидный артрит (РА) – полигенное ауто-
иммунное заболевание, которое является се
рьезной проблемой современной ревматологии 
вследствие распространенности заболевания в 
популяции (до 1%), поражения лиц молодого 
трудоспособного возраста, быстрой инвалидиза
ции пациентов [1]. Своевременная диагностика 
и терапия необходимы для благоприятного ис
хода лечения данного заболевания, также акту
альными являются: разработка путей профилак
тики заболевания, выявление предикторов риска 
развития и неблагоприятного течения болезни. 
В настоящее время пристальное внимание 
ревматологов всего мира приковано к изучению 
доклинической стадии ревматоидного артрита. 
В ряде исследований показано, что «субкли
нически» текущий иммунопатологический 
процесс развивается задолго до клинической 
манифестации артрита. В синовиальной ткани 
клинически «незатронутых» суставов обна
руживается активный воспалительный про
цесс с инфильтрацией макрофагами и гипер
продукцией провоспалительных цитокинов, 
что свидетельствует о наличии определенного 
промежутка времени между развитием воспа
лительного процесса в суставах и клинической 
манифестацией артрита [2]. Итогом работы экс
пертов по доклинической стадии ревматоидно
го артрита стали опубликованные в 2012 году 
Европейские рекомендации, которые опреде
лили специфические фазы, предшествующие 
развитию РА [3]. Большое значение в оценке 
развития и прогрессирования РА придается 
таким маркерам заболевания, как антитела к 
циклическому цитруллинированному пептиду 
(АЦЦП), ревматоидный фактор, C-реактивный 
белок и наличие аллелей общего эпитопа (SE
гена 
HLA-DRB1
 [4]. 
Во многих исследованиях было отмечено 
выявление АЦЦП задолго до появления пер
вых симптомов РА [5]. В настоящее время вы
деляют два основных подтипа ревматоидного 
артрита
– позитивного по АЦЦП и негатив
ного по этому иммунологическому маркеру, 
которые различаются по течению, прогнозу и 
ответу на проводимую терапию [6, 7]. 
При изучении влияния генотипа наиболее 
значимая роль в формировании подверженно
сти к заболеванию доказана для HLA-DRB1 
аллелей общего эпитопа (shared epitope   SE) 
класса
II главного комплекса гистосовмести
Молекулярная и прикладная генетика. Том 20, 2016
г.
Е.А. Аксенова и др.
 Частота HLA-DRB1 аллелей и генотипов у пациентов с АЦЦП-позитивным вариантом...
мости (ГКГС) [8]. Эти аллели кодируют ами
нокислотные последовательности (QRRAA, 
QKRAA, RRRAA), локализованные в позиции 
70–74 третьего гипервариабельного района бета 
цепи главного комплекса гистосовместимости 
класса
II [9, 10]. Аминокислотная последова
тельность общего эпитопа SE расположена в 
кармане
4 (Р4) сайта связывания HLA-DRB1 
молекулы c пептидами и обеспечивает поло
жительный заряд данной области [11]. Это су
щественно увеличивает сродство HLA-DRB1 
к цитруллинированным пептидам, в которых 
в результате посттрансляционной модифика
ции происходит преобразование аргинина бо
ковой цепи в цитруллин (замена заряженной 
имино
группы боковой цепи на незаряженный 
карбонил), и это, соответственно, вызывает 
ауто-иммунный ответ CD4+ T-лимфоцитов на 
эти пептиды [10]. Наличие SE-аллелей локу
са HLA-DRB1 напрямую связано с тяжестью 
эрозивного поражения суставов [12]. В целом 
вклад генов главного комплекса гистосовме
стимости 
HLA
 в структуру генетической ком
поненты РА, на основании оценки данных по
пуляционных и клинических исследований 
среди монозиготных близнецов и сиблингов, 
составляет 37% [13]. Наличие семейных слу
чаев развития заболевания позволяет ревмато
логам изучить наиболее уязвимый контингент 
для выявления лиц с преклинической стадией 
РА, а также разработать схемы фармакотерапии, 
позволяющие предотвратить развитие болезни. 
Основной задачей, решаемой в нашем ис
следовании, было изучение спектра и частоты 
встречаемости аллелей гена 
HLA-DRB1
 у паци
ентов с АЦЦП-позитивным подтипом ревма
тоидного артрита и их родственников первой 
и второй степени родства. Результаты важны 
для разработки в Республике Беларусь ком
плексной программы профилактики развития 
ревматоидного артрита у лиц с отягощенным 
по заболеванию наследственным анамнезом.
EULAR
) 2010
года с продолжительностью су
ставного синдрома до года, без предшествую
щей базисной терапии, позитивные по нали
чию АЦЦП, а также для исследования были 
приглашены родственники этих пациентов 1-й 
и 2-й степени родства (61
человек).
Материалом исследования была тотальная 
ДНК, выделенная из сухих пятен крови. Гено
типирование по аллелям гена 
HLA-DRB1
 было 
проведено с использованием набора SeCore® 
DRB1, DRB3, 4 &
Locus Sequencing Kit (RUO) 
от компании Life Technologies по протоколу к 
данному набору с нашими модификациями. 
Материалы и методы
На базе отделения ревматологии УЗ «6-я 
городская клиническая больница г. Минска» 
было проведено клиническое обследование 
51
пациента с достоверным диагнозом РА 
соответствии с классификационными крите
риями Американской коллегии ревматологов 
ACR
) и Европейской лиги против ревматизма 
Результаты и обсуждение
Специфичность ГКГС II
класса обеспечива
ется, в первую очередь, полиморфными амино
кислотными последовательностями в карманах 
(впадинах) этих молекул [11]. В
третьем гипер
вариабельном районе β1 цепи ГКГС II
класса 
аминокислотная последовательность Q/R-K/R-
R-A-A в 70–74 позициях названа общим эпи
топом (SE) предрасположенности к РА [9, 10]. 
Она находится в четвертом кармане (рocket 4
Р4) молекулы HLA-DR1 и обеспечивает по
ложительный заряд на поверхности кармана 
[11]. Таким образом, молекула HLA-DR1 с SE 
обладает высоким сродством к пептидам, не
сущим нейтральный или отрицательный заряд. 
И поэтому при деиминировании положительно 
заряженной имино-группы аргинина боковой 
цепи ферментом пептидил-аргинин деиминазой 
(ПАД) на незаряженный карбонил с образова
нием цитруллина возрастает сродство таких 
цитруллин
содержащих белков к заякориванию 
в Р4 кармане с SE. При этом немаловажное зна
чение имеет не только заряд на поверхности 
кармана с SE, но и его размер [10]. 
Аллели общего эпитопа SE главного ком
плекса гистосовместимости класса
II HLA-
DRB1 следующие: *0101,*0102, *0401, *0404, 
*0405, *0408, *1001 и *1402 (табл.
1). Ал
лели, которые не кодируют общий эпитоп 
(Х-аллели), но отличаются по электрическому 
заряду на поверхности кармана Р4, обознача
ют: 1)
аллель XP4р
– DRB1*X, заряд карма
на P4 положительный (+); 2)
аллель ХР4n
DRB1*X, заряд кармана P4 нейтральный (N) 
или отрицательный (–) [14]. Аминокислотные 
последовательности и названия аллелей HLA-
DRB1 представлены в
табл.
Молекулярная и прикладная генетика. Том 20, 2016
г.
Е.А. Аксенова и др.
 Частота HLA-DRB1 аллелей и генотипов у пациентов с АЦЦП-позитивным вариантом...
Аминокислотная 
1109
1101
1104
1106
1102
1103
Тип
XP4p
XP4p
XP4p
XP4p
XP4p
XP4p
XP4n
XP4n
XP4n
XP4n
XP4n
XP4n
XP4n
XP4n
XP4n
Таблица 1 
Полиморфные аминокислоты в HLA-DR кармане 4 (Р4) DRβ1 цепи [14]
Примечание: SE – аллели общего эпитопа, Х – аллели, которые не относятся к общему эпитопу, но отличаются по электрическому заряду на поверхности кармана Р4: 
XP4р – DRB1*X P4 положительный (+); 2) ХР4n – DRB1*X P4 нейтральный (N) или отрицательный (–)
Мы изучили генотипы 51
пациента с до
стоверным диагнозом РА, которые имели 
положительные результаты серологическо
го теста на АЦЦП. Данные представлены в 
табл.
2. Обладателями HLA-DRB1 аллелей 
общего эпитопа главного комплекса гисто
совместимости класса II были 35 из
циента. У
пациентов из 35 в генотипе два 
SE-аллеля (двойная доза), а
16
пациентов, 
наряду с SE-аллелем, имели «протектив
ный» DRB1*ХР4n аллель (табл.
Сопоставление генотипов родственников с 
генотипами пациентов показало, что у род
ственников пациентов также генотипированы 
аллели общего эпитопа (SE) HLA-DRB1 локу
са, более того, у 4
родственников 4
пациентов с 
генотипом
X/X выявлены SE-аллели (табл.
3), 
при этом показатели АЦЦП были у этих род
ственников отрицательными. В группе из 
17
АЦЦП-позитивных родственников (>5
Ед/
мл) встречались разные генотипы HLA-DRB1, 
включая нейтральные (XP4p/XP4p и XP4p/
XP4n) и «протективные» (XP4n/XP4n), а алле
ли общего эпитопа детектировались у
чело
век (табл.
3). При сопоставлении всего спектра 
генотипов достоверных различий между груп
пами пациентов и родственников не выявлено. 
Исследования, проведенные Reviron с кол
легами на 3
поколениях жителей Франции, 
показали, что генотип DRB1*SE/XP4p до
стоверно ассоциирован с развитием РА (OR
4,4; 
< 0,001). Тогда как аллель DRB1*XP4n, 
кодирующий нейтральную или отрицатель
но заряженную аминокислотную последо
вательность, в 3–5
раз реже встречался в 
генотипах людей с РА без SE-аллелей, чем 
в контрольной выборке здоровых людей. На 
основании этого был сделан вывод о том, что 
аллели DRB1*XP4n снижают риск развития 
РА, т.е.
могут быть названы «протективны
ми», если они не сочетаются с SE-аллелем в 
генотипе [14]. Среди изученных нами паци
ентов чаще всего (у 31,3%) встречались гено
типы SE/XP4n, сочетающие аллель общего 
эпитопа и «протективный». Их частота в 3 
поколениях населения Франции варьировала 
в пределах 23,3–29,5% и также существенно 
не отличалась от контрольной выборки [14]. 
В нашем исследовании самым распростра
ненным среди пациентов с РА был аллель 
DRB1*04:01:01 общего эпитопа (табл.
2)
Молекулярная и прикладная генетика. Том 20, 2016
г.
Е.А. Аксенова и др.
 Частота HLA-DRB1 аллелей и генотипов у пациентов с АЦЦП-позитивным вариантом...
Таблица 3
Частота встречаемости генотипов гена
у пациентов с РА и их родственников 
Генотип
Родственники
Всего (n)
X/X пациентов 
Пациентов 
Родственников
2 (11,8)
11,8
2 (11,8)
11
11,8
11
2 (11,8)
Таблица 2 
Частота встречаемости аллелей гена 
у АЦЦП-позитивных пациентов 
с диагнозом РА
Типы аллелей
Число
пациентов,
(n)
Гомозигот,
(n, %)
Частота 
аллелей,
(%)
Генотипов в сочетании с аллелями общего эпитопа, (n, %)
DRB1*04:01:01
DRB1*01:01:01
DRB1*10:01:01
DRB1*04:10:01
Общий эпитоп
B1*01:01:01
B1*04:01:01
B1*04:05:01
B1*04:10:01
B1*10:01:01
ХР4n
DRB1*04:02
DRB1*07:01:01
DRB1*08:01:01
DRB1*11:01:01
11,76
DRB1*12:01:01
DRB1*13:01:01
DRB1*13:02:01
P4p
DRB1*03:01:01
DRB1*09:01:01
DRB1*15:01:01
DRB1*15:02:01
DRB1*16:01:01
DRB1*16:02:01
Молекулярная и прикладная генетика. Том 20, 2016
г.
Е.А. Аксенова и др.
 Частота HLA-DRB1 аллелей и генотипов у пациентов с АЦЦП-позитивным вариантом...
Заключение
Проведенное нами исследование генотипов 
51
пациента с АЦЦП-позитивным ревматоидным 
артритом показало, что 68,6% имели аллели обще
го эпитопа SE, обеспечивающие высокое сродство 
DRβ1 цепи ГКГС к цитруллинированным пепти
дам. Наиболее частым (19,61%) в изученной вы
борке был SE-аллель DRB1*04:01:01, следующим 
по распространенности (15,69%) определен ней
тральный XP4p-аллель DRB1*15:01:01 и с час-
тотой 13,73% выявлен SE-аллель DRB1*01:01:01 
(табл.
1). 15,7%
пациентов имели в своем генотипе 
SE-аллеля, причем 3
человека были гомозигот
ными по аллелю DRB1*04:01:01. В
31,3%
случа
ев РА встречались генотипы SE/XP4n, сочетаю
щие аллель общего эпитопа и «протективный». 
4,9%
родственников пациентов обнаружены 
генотипы SE/SE и у большинства (29,5%) – ге
нотипы SE/XP4n. Среди 61
родственника паци
ентов 17 были АЦЦП-позитивными (>5 Ед/мл) 
и имели разные генотипы HLA-DRB1, включая 
нейтральные (XP4p/XP4p и XP4p/XP4n) и «про
тективные» (XP4n/XP4n). Достоверных различий 
между группами пациентов и родственников по 
частоте генотипов и аллелей не
выявлено. Даль
нейшее изучение прогрессирования болезни и 
реакции на лечение у
исследованных пациентов 
позволит оценить вклад генотипа и перспективы 
его применения в качестве прогнозного маркера 
для ранней диагностики заболевания.
Работа выполнена по заданию 1.2.109 ГПНИ 
«Медицина и фармация», подпрограмма «Фун
даментальная и прикладная медицина».
Список использованных источников
Насонов, Е.Л. Почему необходима 
ранняя диагностика и лечение ревматоидного 
артрита? / Е.Л. Насонов // Русск. мед. 
журнал.
– 2002. – Т.
10, №
22. – С.
Asymptomatic synovitis precedes clini
cally manifest arthritis/ M.C.
Kraan [et
al.] // Ar
thritis Rheum. – 1998. – Vol.
41, N
8. – P.
EULAR recommendations for termino-
logy and research in individuals at risk of rheu
matoid arthritis: report from the Study Group for 
Risk Factors for Rheumatoid Arthritis / D.M. 
Gerlag [et
al.] // Ann Rheum Dis. – 2012. – 
Vol.
71. – P.
638–641. – doi:10.1136/annrheum
dis-2011-200990.
Predicting arthritis outcomes – what can be 
learned from the Leiden Early Arthritis Clinic? / 
D.P.C.
De Rooy [et
al.] // Rheumatology. – Ox
51, Vol.
1. – P.
5.
The extent of the anti-citrullinated protein an
tibody repertoire is associated with arthritis develop
ment in patients with seropositive arthralgia / L.A. van 
de Stadt [et
al.] // Ann Rheum Dis. – 2011. – Vol.
70, 
1. – P.
128–133. – doi: 10.1136/ard.2010.132662. 
The association of treatment response and 
joint damage with ACPA-status in recent-onset 
RA: a subanalysis of the 8-year follow-up of the 
BeSt study / M.
Broek [et
al.] // Ann 
Rheum Dis. – 2012. – Vol.
71, N
2. – P.
– doi: 10.1136/annrheumdis-2011-200379. 
Bax, M. The pathogenic potential of auto-
reactive antibodies in rheumatoid arthritis / 
Bax, T.W.
Huizinga, R.E.
Toes // Semin Im
munopathol. – 2014. – Vol.
36, N
3. – P.
8.
Validation of the reshaped shared epitope 
HLA-DRB1 classi�cation in rheumatoid arthritis 
/ L.
Michou [et
al.] // Arthritis Res Ther. – 2006. – 
Vol.
8, N
3. – R.
79.
9.
Gregersen, P.K. The shared epitope hypo-
thesis. An approach to understanding the molecu
lar genetics of susceptibility to rheumatoid arthri
tis / P.K.
Gregersen, J.
Silver, R.J.
Winchester // 
Arthritis and Rheumatism. – 1987. – Vol.
30, 
N.
11.
– P.
1205–1213. 
10.
Cutting edge: the conversion of arginine to 
citrulline allows for a high-af�nity peptide interac
tion with the rheumatoid arthritis-associated HLA-
DRB1*0401 MHC class
II molecule / J.A.
Hill [et
al.] 
// J. Immunol. – 2003. – Vol.
171, N
2. – P.
538–541. 
11.
Crystal structure of the human class II 
MHC protein HLA-DR1 complexed with an in
�uenza virus peptide / L.J.
Stern [et
al.] // Na
ture. – 1994. – Vol.
6468. – P.
Value of the HLA-DRB1 shared epitope 
for predicting radiographic damage in rheu
matoid arthritis depends on the individual risk 
pro�le / A.C.
Janssens [et
al.] // J
Rheumatol. – 
2006. – Vol. 33. – P. 2383–2389.
The contribution of HLA to rheumatoid 
arthritis / C.M.
Deighton [et
al.] // Clin Genet. – 
1989. – Vol.
3. – P.
In�uence of shared epitope-negative HLA-
DRB1 alleles on genetic susceptibility to rheu
matoid arthritis / D. Reviron [et
al.] // Arthritis 
Rheum. – 2001. – Vol.
3. – P.
Молекулярная и прикладная генетика. Том 20, 2016
г.
Е.А. Аксенова и др.
 Частота HLA-DRB1 аллелей и генотипов у пациентов с АЦЦП-позитивным вариантом...
, O.V. 
.P. Mitkovskaya
S AN
N PAT

AT
RTHR
S AN
ST 
LAT
Institute of Genetics and Cytology of the National Academy of Sciences of Belarus
Minsk BY-220072, Republic of Belarus
Minsk BY-220116, Republic of Belarus
 genotyping of 51 patients with ACCP antibody-positive rheumatoid arthritis revealed the 68,6% 
frequency of shared epitope (SE) alleles which contribute to citrullinated peptide-binding speci�city of DRβ1 chain 
of MHC. SE-allele DRB1*04:01:01 was the most frequent (19,61%) in studied group. 15,69% patients had neutral 
DRB1*15:01:01 allele and 13,73% – SE-allele DRB1*01:01:01. The majority (31,3%) RA patients possessed SE/XP4n 
genotypes, combining SE and “protective” alleles. The occurrence of SE/SE genotypes in RA patients was 15,7%. 
Three patients had DRB1*04:01:01 homozygote genotype. The frequency of SE/SE genotypes in 61 nearest relatives 
of RA patients were 4,9%. 29,5% relatives had SE/XP4n genotypes. We didn’t �nd signi�cant differences in alleles 
, ACCP, shared epitope.
Дата поступления статьи 9 февраля 2016 г.
Молекулярная и прикладная генетика. Том 20, 2016
г.
УДК 575.174.015.3:616.127-007.61
Н.Н. Чакова
, С.С. Ниязова
, С.М. Комиссарова
ВЗАИМОДЕЙСТВИЕ 
АЛЛЕЛЬНЫХ
ВАРИАНТОВ
СИМПАТОАДРЕНАЛОВОЙ И РЕНИН-АНГИОТЕНЗИН-
АЛЬДОСТЕРОНОВОЙ СИСТЕМ ПРИ ГИПЕРТРОФИЧЕСКОЙ 
КАРДИОМИОПАТИИ
Институт генетики и цитологии НАН Беларуси
Республика Беларусь, 220072, г. Минск, ул. Академическая, 27; e-mail: [email protected]
РНПЦ «Кардиология»
220036, Республика Беларусь, г. Минск, ул. Р. Люксембург, 110
С помощью метода сокращения многофакторной размерности (Multifatorial Dimensionality Reduction, MDR) 
изучен характер взаимодействия 9 полиморфных локусов генов симпатоадреналовой (
ADRB
, ADRB
2) и ренин-
ангиотензин-альдостероновой систем (
АСЕ, AGTR
, CYP11B
, AGT, CMA
1) и дана оценка их независимого и суммар
ного вклада в патогенез гипертрофической кардиомиопатии (ГКМП). Показано существование половых различий 
в установленных межгенных взаимосвязях и в их прогностической значимости для пациентов c ГКМП. Проведено 
моделирование взаимодействия аллельных вариантов перечисленных генов и определены комбинации полиморф
ных локусов с наибольшей рисковой значимостью в отношении реализации клинических проявлений ГКМП.
Ключевые слова: 
генетический полиморфизм, ренин-ангиотензин-альдостероновая система (РААС), сим
патоадреналовая система (САС), межгенные взаимодействия.
Введение
Ренин-ангиотензин-альдостероновая (РААС) 
и симпатоадреналовая (САС) системы являются 
основными системами регуляции кровообра
щения, взаимно влияющими друг на друга [1]. 
Одним из наиболее значимых факторов РААС
в отношении фенотипических проявлений ги-
пертрофической кардиомиопатии (ГКМП) яв
ляется ангиотензин
II (АII), повышенный уро
вень которого способствует гипертрофии кар
диомиоцитов, пролиферации фибробластов в 
миокарде и избыточному синтезу коллагена 
[2]. При этом АII значительно усиливает дей
ствие САС на сердце и сосуды, увеличивая вы
свобождение норадреналина и повышая чув
ствительность адренергических рецепторов 
к агонистам (адреналину и норадреналину). 
Стимуляция же симпатических нервов, идущих 
к почке, сопровождается высвобождением ре
нина, расщепляющего ангиотензиноген с об
разованием неактивного АI, который под дей
ствием ангиотензин-превращающего фермента 
преобразуется в активный АII. Благодаря этим 
взаимным влияниям активация САС и РААС 
происходит независимо от того, какая система 
была первично активирована [1]. 
Одной из причин повышенного уровня 
ангиотензина
II может быть аллельный по
лиморфизм различных генов РААС, в том 
числе кодирующих ангиотензиноген (
AGT
), 
ангиотензин-превращающий фермент (
химазу (
1), рецептор ангиотензина
II ти
па
I (
AGTR
1) и альдостеронсинтазу (
CYP
11
2) 
[2]. В свою очередь функциональные свойства 
и β2-адренорецепторов определяются по
лиморфизмом кодирующих их генов (
2) [3]. Большое количество работ по
священо изучению полиморфизма генов, от
вечающих за синтез белков РААС и САС, 
и его влиянию на возникновение и течение 
сердечно-сосудистых заболеваний различно
го генеза [3, 4], в
т.ч. и
ГКМП [2, 5, 6], однако 
практически отсутствуют исследования, где 
бы при этом учитывался суммарный вклад ал
лельных вариантов генов этих систем.
Целью данной работы являлась оценка харак
тера взаимодействий полиморфных локусов 
генов симпатоадреналовой (
ADRB
, ADRB
2) 
и ренин-ангиотензин-альдостероновой си
стем (
АСЕ, AGTR
, CYP
11
B2, AGT, CMA
1) 
в патогенезе гипертрофической кардиомио
патии.
Молекулярная и прикладная генетика. Том 20, 2016
г.
Н.Н. Чакова и др.
 Взаимодействие аллельных вариантов генов симпатоадреналовой...
Материалы и методы 
возможно оценить с помощью традиционно 
используемых в генетических исследованиях 
статистических методов [9].
В исследование были включены 285
па
циентов с диагнозом ГКМП (100
женщин и 
мужчин), проходивших лечение в РНПЦ 
«Кардиология», г.
Минск. В
контрольную вы
борку вошли 276
человек без фенотипических 
признаков данной патологии (103
женщины и 
мужчины). 
У всех обследованных индивидуумов ме
тодом ПЦР и ПЦР-ПДРФ-анализа изучали 
полиморфизм генов ренин-ангиотензин-
альдостероновой системы: варианты Т174М 
(rs4762) гена
 AGT, 
1166A>С (rs5186) ге
на 
AGTR
1, -1903A>G (rs1800875) гена 
CMA
I/D- (rs4646994) гена 
АСЕ 
-344С>Т 
гена (rs1799998) 
CYP
11
2, а также иссле
довали
полиморфизм генов симпатоадрена
ловой системы: замены 145A>G
(Ser49Gly) 
(rs1801252)

1165С>G (Arg389Gly) (rs1801253) 
в гене 
ADRB
1 и 46A>G (Arg16Gly) (rs1042713), 
79С>G (Gln27Glu) (rs1042714)
в гене 
Последовательности праймеров, условия про
ведения ПЦР и используемые эндонуклеазы 
были описаны ранее [7, 8]. 
Статистическая обработка полученных 
данных проводилась с помощью
программ
ного пакета Statistica for Windows
6.0. При 
сравнении частот генотипов применяли 
стандартный критерий
 Пирсона. Если 
объем выборки не превышал 5
случаев, ис
пользовали точный критерий Фишера. Ста
тистически значимыми считали различия 
при 
<0,05.
Для анализа суммарного вклада 9
иссле
дуемых аллельных вариантов в фенотипи
ческую реализацию ГКМП и построения 
моделей с наибольшим предсказательным 
потенциалом был использован метод со
кращения многофакторной размерности 
(Multifatorial Dimensionality Reduction, MDR) 
в среде открытой программы MDR v.
2.0 
beta
8.4 (http://www.multifactordimensional
ityreduction.org/). Данный метод позволяет 
проводить оценку взаимодействий большо
го количества полиморфных локусов пу
тем конструирования новых переменных на 
основе суммирования сочетаний генотипов 
как повышенного, так и пониженного риска 
развития болезни. Метод MDR был разра
ботан для моделирования межгенных взаи
модействий высокого порядка, которые не
Результаты и обсуждение 
ГКМП
– тяжелое первичное заболевание 
миокарда, характеризующееся ассиметрич
ной гипертрофией миокарда левого желудоч
ка, развитием нарушений ритма и высоким 
риском внезапной смерти. Наиболее частой 
причиной развития данной патологии явля
ются мутации в генах, кодирующих синтез 
сократительных белков миокарда. Однако на 
выраженность фенотипических признаков 
ГКМП, помимо этих мутаций, значительное 
влияние оказывает также полиморфизм генов-
модификаторов, к которым, в первую очередь, 
относят гены, кодирующие белки РААС и САС 
[2, 5, 10]. Существует мнение, что мутации 
в генах саркомерных белков приводят к на
рушению сократимости миокарда, при этом 
клинические признаки заболевания во многом 
обусловлены степенью активации нейрогумо
ральных систем, которые стремятся адаптиро
вать сердечно-сосудистую систему к новым 
условиям функционирования [11].
На первом этапе работы нами был прове
ден сравнительный анализ распределений 
генотипов каждого из перечисленных выше 
аллельных вариантов генов 
АСЕ

AGTR
1, 
CYP
11
2, 
AGT

CMA
1, 
ADRB
1 и 
ADRB
2 меж
ду группой пациентов с ГКМП и контроль
ной, как без учета половой принадлежности, 
так и в зависимости от пола. Результаты это
го исследования подробно представлены в 
предыдущей статье [8]. В
табл.
1 настоящего 
сообщения отражены данные, демонстри
рующие достоверные различия в отношении 
встречаемости ряда генотипов в сравнивае
мых группах. Следует отметить, что рас
пределение генотипов по генам 
ACE,
CMA
CYP
11

кодирующим белки РААС, имело 
свои особенности в зависимости от пола. До
стоверно большая частота аллеля
D гена
ACE
по сравнению с контрольной группой (55,9% 
против 47,7%) наблюдалась только у паци
ентов мужского пола (χ
4,89, 
0,027), при 
этом генотип
II выявлялся в 1,4
раза реже, а 
генотип
DD
– в 1,4
раза чаще, чем у мужчин 
контрольной выборки (
0,060 и 
0,087, 
соответственно).
Молекулярная и прикладная генетика. Том 20, 2016
г.
Н.Н. Чакова и др.
 Взаимодействие аллельных вариантов генов симпатоадреналовой...
Таблица 1
Распределение частот встречаемости различных генотипов 
11
пациентов с ГКМП и в контрольной группе
Генотип
Общая группа, n (%)
Мужчины, n (%)
женщины, n (%)
Контроль
Контроль
Контроль
I/D-полиморфизм
-1903A>G полиморфизм
311 (56,3)
115 (55,8)
11
-344С>Т полиморфизм
 полиморфизм
114 (65,8)*
Примечание. *
4,89, 
0,027; *
5,48, 
0,019; *
– χ
3,89, 
0,049; *
– χ
5,02, 
0,025; *
– χ
6,60, 
0,010; 
0,004; *
– χ
0,003; *
– χ
0,023; *
0,015; *
0,014; полужирный 
шрифт без звездочки
У женщин с ГКМП (табл.
1) значимыми для 
проявления клинических признаков заболевания 
оказались полиморфизмы двух других генов: 
частоты встречаемости генотипа
AA полимор
физма -1903A>G гена 
CMA
1 и генотипа
TT по
лиморфизма -344С>Т
гена 
CYP
11
2 среди па
циентов были ниже по сравнению с женщинами 
контрольной группы, что говорит о защитной ро
ли данных генотипов. Генотип
СС полиморфиз
ма -344С>Т
гена 
CYP
11
2, напротив, достоверно 
чаще обнаруживался в группе женщин с ГКМП, 
чем в контроле, что указывает на его значимость 
в реализации фенотипа ГКМП у женщин.
При анализе полиморфизма генов 
ADRB
1 и 
ADRB
2, кодирующих белки САС, существен
ные различия были обнаружены (табл.
1) 
только в отношении полиморфизма Ser49Gly 
гена 
ADRB
1, при этом распределение геноти
пов не зависело от пола: у пациентов с ГКМП 
генотип
АА встречался в
1,2
раза чаще, а ге
терозигота AG
– в
1,5
раза реже, чем в соот
ветствующих контрольных группах. В общей 
группе пациентов и у мужчин с ГКМП эти 
различия были достоверными, а у женщин с 
– имели уровень тенденции (
и 
0,075, соответственно). Отсюда следует, 
Молекулярная и прикладная генетика. Том 20, 2016
г.
Н.Н. Чакова и др.
 Взаимодействие аллельных вариантов генов симпатоадреналовой...
что наличие гомозиготного генотипа
AA
гена 
ADRB
1 (Ser49Gly) способствует реализации 
фенотипических проявлений ГКМП во всей 
исследованной популяции, однако в большей 
степени у мужчин. 
В последние годы широко обсуждается 
существование полового диморфизма в про
текании различных заболеваний, особенно 
сердечно-сосудистых (ССЗ), а также генети
ческая детерминация этого явления [12–14]. 
В распространенности и течении ГКМП так
же прослеживаются гендерные особенности. 
Так, мужчин среди заболевших больше, чем 
женщин, несмотря на то, что ГКМП относит
ся к заболеваниям с аутосомно-доминантным 
типом наследования и теоретически его рас
пространенность должна быть одинакова у 
обоих полов [15]. При этом средний возраст 
манифестации ГКМП у женщин статистиче
ски значимо выше, чем у мужчин с ГКМП.
Для ряда генов, участвующих в возникно
вении CCЗ, показано, что ассоциированный 
с риском развития заболевания
аллель
может 
проявляться либо у мужчин, либо у женщин 
[16]. Различия в распределении генотипов по 
некоторым полиморфным маркерам у муж
чин и женщин в группах пациентов с ССЗ и 
контрольной группе объясняют различным 
влиянием половых гормонов на функциони
рование этих аллелей. Считается, что эстро
гены обладают выраженными протектив
ными свойствами при кардиоваскулярных 
патологиях [17]. Возможным механизмом их 
защитного действия на сердечно-сосудистую 
систему является подавление экспрессии 
некоторых генов, ответственных за регу
ляцию кровяного давления, в том числе и 
ангиотензин
превращающего фермента [18]. 
С другой стороны, наблюдаемые различия в 
ассоциациях полиморфных вариантов генов 
РААС с фенотипической реализацией ССЗ, в 
том числе и ГКМП, по-видимому, могут ука
зывать на то, что полиморфизм этих генов 
является одной из генетических причин по
лового диморфизма при
ГКМП.
С помощью программы MDR нами была 
проведена оценка характера взаимодействия 
полиморфных локусов генов, кодирующих 
белки САС и РААС. Анализ данных этим 
методом также показал существование по
ловых различий, как в самих взаимосвязях 
исследуемых полиморфных локусов, так и 
в их иерархии у пациентов ГКМП. На ри
сунке представлен граф межгенных взаи
модействий, отражающий силу влияния 
отдельных факторов риска на реализацию 
клинической картины ГКМП в виде пока
зателя энтропии
I, которая выражается в 
% для каждого узла. Наибольшее влияние 
имеют полиморфизмы с максимальным 
процентом энтропии. В случае, если
I 0%, 
ген не оказывает влияния на развитие забо
Рисунок.
 Графическое изображение взаимодействия полиморфных локусов изучаемых генов при ГКМП: 
– у мужчин; б
– у женщин.
Примечание. На вершинах многогранника представлена информационная ценность каждого полиморфного 
локуса в отдельности, на ребрах
– информационная ценность взаимодействия пары локусов
Синергизм
Антагонизм
0,02%
0,30%
CYP11B2
CYP11B2
0,96%
0,27%
0,25%
0,36%
0,20%
1,77%
-0,11%
-0,11%
0,16%
Молекулярная и прикладная генетика. Том 20, 2016
г.
Н.Н. Чакова и др.
 Взаимодействие аллельных вариантов генов симпатоадреналовой...
левания. Анализ уровня энтропии показал, 
что наиболее весомыми факторами риска 
развития клинических проявлений ГКМП 
у мужчин являются полиморфизм Ser49Gly 
гена 
ADRB
1 (I 1,64%) и
I/D полиморфизм 
гена 
ACE
 (I 0,96%) (рис., а); у женщин наи
большую значимость имел полиморфизм 
-344С>Т гена 
CYP
11
2 (H 2,41%), на вто
ром месте был полиморфизм -1903A>G
гена 
CMA
1 (I 1,77%), а на третьем
– полимор
физм Ser49Gly гена 
ADRB
1 (I 1,15%). 
На ребрах графа в процентах указаны зна
чения межфакторной энтропии, а цветом 
отображен характер взаимосвязей внутри 
модели (синергизм, антагонизм). Наиболее 
существенные 2-х и 3-х-локусные комбина
ции полиморфизмов, для которых величина 
показателя информативности
I была выше, 
чем для каждого полиморфизма в отдельности, 
представлены в табл.
2. Все представленные 
в таблице 2-х и 3-х-межлокусные комбинации 
вносят статистически значимый вклад в реа
лизацию фенотипических признаков ГКМП, 
однако их уровень информативности различа
ется в зависимости от пола. Максимальный си
нергетический эффект у мужчин для 2-х
локу
сов наблюдался в комбинации «
для 3-х
– «
ADRB
2(16)» (4,04%), у женщин
– «
CMA
2(16)» (4,14%)
и «
× CYP
11
(5,88%), соответственно.
С использованием алгоритма всесторонне
го поиска (Exhaustive Search Algorithm), кото
рый оценивает значимость всех возможных 
комбинаций полиморфных вариантов, были 
установлены наиболее оптимальные модели 
взаимодействия аллелей генов: у мужчин
2-х-локусная модель взаимодействия генов 
ADRB
1(49)
ACE
» (
<0,0001) с воспроиз
водимостью (Cross-validation Consistency) 80% 
и точностью предсказания (Testing Balanced 
Accuraсy) 59,53%, у женщин
– 4-х-локусная 
модель взаимодействия генов «
CMA
11
× ACE
× ADRB
2(16)» (
<0,0001) с 
воспроизводимостью 80% и точностью пред
сказания 74,75%.
Последующая оценка характера распределе
ния полиморфных вариантов генов в пределах 
каждой модели позволила выделить комби
нации генотипов, которые достоверно чаще 
встречались в группе пациентов с ГКМП, по 
сравнению с контрольной, и имели наиболь
шую рисковую значимость в формировании 
клинической картины ГКМП (табл.
Таблица 2
Комбинации генов САС и РААС, имеющих наибольший уровень информативности 
у пациентов с ГКМП 
Число локусов 
в модели
Комбинации полиморфизмов 
Показатель энтропии (I),%
Мужчины 
женщины 
× ADRB
× ACE 
× ADRB
× AGT
× ADRB
× AGT
× ACE
× ADRB
11
× ADRB
11
× ADRB
× ADRB
× ADRB
11
× ADRB
11
× ACE
– максимальный синергетический эффект для 2-х-локусной комбинации; **
– максимальный синергетический эффект для 
3-х-локусной комбинации 
Молекулярная и прикладная генетика. Том 20, 2016
г.
Н.Н. Чакова и др.
 Взаимодействие аллельных вариантов генов симпатоадреналовой...
Таблица 3
Наиболее значимые комбинации генотипов, ассоциированные с развитием фенотипических 
признаков ГКМП
Комбинации генотипов
Мужчины, n
женщины, n
Контроль
Контроль
аллель
112
 аллель
11
11
 аллель
11
11
аллель
аллель
 аллель
 аллель
аллель
11
A
Примечание. Полужирным шрифтом выделены достоверные различия между группой пациентов и контролем
Анализ данных (табл.
3) показал наличие 
значительного полового диморфизма в ас
социациях комбинаций исследуемых поли
морфизмов с риском развития клинических 
проявлений ГКМП. Для мужчин с данным 
заболеванием неблагоприятными являют
ся сочетание генотипа
АА (Ser49Gly)
и СС 
(Arg389Gly) гена 
ADRB
1. Комбинации, вклю
чающие хотя бы один из этих генотипов 
ADRB
1, и определенные варианты генов, ко
дирующих белки РААС (
ACE, CMA
, AGT
), 
увеличивали риск проявления фенотипа 
ГКМП у мужчин. У женщин полиморфные 
варианты генов РААС
CYP
11
 CMA
1) 
оказывали определяющее влияние, которое 
усиливалось в комбинации с представлен
ными в
табл.
3 генотипами
генов
ADRB
(Ser49Gly)
ADRB
2 (Arg16Gly) и
 ACE
. В от
ношении гена 
АСЕ
 следует отметить, что для 
мужчин рисковую значимость имели комби
нации с аллелем
D, тогда как у женщин
– с 
аллелем
I. Сочетание генотипов «
CMA
GG
CYP11B2_
СT
× ACE_
II»
было выявлено толь
ко у женщин с ГКМП и не встречалось в кон
трольной группе.
Наряду с рисковыми комбинациями были 
обнаружены сочетания полиморфных локусов 
генов САС и РААС, которые чаще встречались 
в контрольной группе по сравнению с группой 
пациентов и тем самым являлись протектив
ными в отношении реализации клинических 
проявлений ГКМП (табл.
Молекулярная и прикладная генетика. Том 20, 2016
г.
Н.Н. Чакова и др.
 Взаимодействие аллельных вариантов генов симпатоадреналовой...
Таблица 4
Наиболее значимые протективные комбинации генотипов 
Комбинации генотипов
Мужчины, n
женщины, n
Контроль
Контроль
0,118
аллель
11
11
7,11
 аллель
11
11
11
 аллель
 аллель
аллель
A ×
аллель
11
11
 аллель

 аллель
Примечание. Полужирным шрифтом выделены достоверные различия между группой пациентов и контролем
Независимо от пола было выявлено ста
тистически значимое уменьшение в
2,3
раза 
частоты встречаемости двойной гетерози
готы «
ADRB
1(49)_AG
× 
ADRB
1(389)_CG» 
пациентов с диагнозом ГКМП по сравне
нию с контрольной группой. Усиление про
тективной значимости этого гаплотипа на
блюдалось в сочетании его с гомозиготным 
генотипом
GG полиморфизма Arg16Gly ге
на 
ADRB
 комбинация «
ADRB
1(49)_AG
ADRB
1(389)_CG
× 
ADRB
2(16)_GG)» еще ре
же (достоверно в
раз) встречалась у пациен
тов с ГКМП обоих полов по сравнению с кон-
тролем. 
У мужчин защитная роль комбинации 
одного из перечисленных генотипов 
ADRB
увеличивалась также в присутствии гено
типа
СТ гена
CYP
11
2, генотипа
АА гена 
AGTR
1 и генотипа
CC гена 
ADRB
2 (Gln27Glu). 
В группе женщин с ГКМП протективная зна
чимость генотипа
АА гена 
СМА
 и аллеля
гена 
CYP
11
2 усиливалась в комбинации с 
определенными вариантами гена 
ADRB
2 и 
генотипом
II гена 
ACE
. Сочетание геноти
пов «
CYP
11
2_аллель
× 
ACE
_II
× 
CMA
1_
AA» было обнаружено только в контрольной 
группе женщин и не выявлено у пациенток с 
ГКМП. 
Молекулярная и прикладная генетика. Том 20, 2016
г.
Н.Н. Чакова и др.
 Взаимодействие аллельных вариантов генов симпатоадреналовой...
Надо сказать, что некоторые генотипы вхо
дили в состав как «благоприятных», так и 
«неблагоприятных» комбинаций. Например, 
у мужчин генотип
CC гена 
ADRB
2 (поли
морфизм Gln27Glu) в сочетании с
II геноти
пом
гена 
 имел протективное значение, а 
в комбинации с генотипом
DD этого же гена 
повышал риск проявления фенотипа ГКМП. 
Можно предположить, что в данном случае 
определяющее значение имеют варианты гена 
АСЕ
, однако эффект его наиболее ярко прояв
ляется у носителей генотипа
CC гена
 ADRB
Аналогичная картина наблюдалась у женщин 
в отношении генотипа

полиморфизма 
Ser49Gly гена
 ADRB

прогностическая зна
чимость которого
существенно
зависела от 
генотипов
11
Следует подчеркнуть, что различия в частоте 
встречаемости генотипов
II и DD гена 
 в 
исследуемых группах в целом были не значи
мы или имели характер тенденции (в группе 
мужчин) (табл.
1), в то время как при сочета
нии данных генотипов с определенными поли
морфными вариантами других генов
эти раз
личия становились статистически значимыми. 
Из данных литературы известно, что аллель
ассоциирован с почти двукратным увеличени
ем содержания ангиотензин-превращающего 
фермента, а также с повышенным риском раз
вития кардиомиопатии у индусов и европейцев 
[2, 19, 20]. В нашем исследовании показано, 
что генотип
DD или аллель
D являлись риско
выми при наличии определенных генотипов 
других генов, кодирующих белки РААС и САС.
взаимодействия генов «
ADRB
1(49)
ACE
<0,0001), у женщин
– 4-х-локусная «
CMA
11
× ACE
× ADRB
Показано также, что прогностическая зна
чимость генотипа
ACE 
в патогенезе ГКМП 
зависит от пола пациента и модифицируется 
присутствием определенных генотипов других 
генов, кодирующих белки РААС и САС.
Заключение
В результате проведенного анализа с ис
пользованием метода MDR был установлен 
сложный характер межгенных взаимодействий 
САС и РААС, которые, по-видимому, оказы
вают существенное влияние на реализацию 
клинических проявлений ГКМП, а также на 
проявление полового диморфизма в патоге
незе этого заболевания. Выявлены рисковые 
и протективные комбинации определенных 
аллелей и генотипов с учетом половой при
надлежности пациентов. Построены наи
более оптимальные модели взаимодействия 
аллелей генов: наибольшую прогностиче
скую значимость в формировании фенотипа 
ГКМП у мужчин имела 2-х-локусная модель 
Список использованных источников
1. Коваленко, В.Н. Ренин-ангиотензиновая 
система в кардиальной патологии / В.Н.
Ко
валенко, Т.В.
Талаева, В.В.
Братусь // Укр. 
кардіол. журн.
2.
Impact of polymorphisms
In the renin-angio
tensin-aldosterone system on hypertrophic cardio
myopathy / E.
Orenes–Piñero [et
al.] // J.
Angiotensin Aldosterone Syst.
– 2011.
– Vol.
– P.
3. Brodde, O.E. Beta-1 and beta-2 adrenoceptor 
polymorphisms: functional
Importance,
Impact 
on cardiovascular diseases and drug responses 
/ O.E.
Brodde // Pharmacol. Ther.
– 2008.
Vol.
117.
– P. 1-29.
4. Wang, J.G. Genetic polymorphisms
In the 
renin-angiotensin system: relevance for suscep
tibility to cardiovascular disease / J.G.
Wang, 
J.A.
Staessen // Eur. J.
Pharmacol.
– 2000.
Vol.
– P.
Khullar, M. Role of modi�er genes
pathic cardiomyopathies / M.
Khullar, B.
A.
Bahl // Atherosclerotic Cardiovascular Di
InTech, 2011.
– P.
6.
 Osadchii, O.E.
Cardiac hypertrophy
Induced 
by sustained beta-adrenoreceptor activation: pat
hophysiological aspects / O.E.
Osadchii // Heart. 
Fail. Rev.
– Vol.
P.
7. Влияние полиморфизма генов ренин-
ангиотензин-альдостероновой системы на 
выраженность клинических признаков гипер
трофической кардиомиопатии / С.С.
Ниязова 

др.] // Молекулярная и прикладная гене
тика: сб. науч. тр.
– Минск, 2013.
– Т.
16.
С.
16–23.
8. Гендерные особенности распределе
ния полиморфных вариантов генов 
ADRB1, 
ADRB2, ACE, AGT, AGTR1, CYP11B2
 и 
у пациентов с гипертрофической кардиоми
опатией / С.С.
Ниязова [и
др.] // Весці На
цыянальнай акадэміі навук Беларусі. Серыя 
медыцынскіх навук.
– 2014.
– №
– С.
Молекулярная и прикладная генетика. Том 20, 2016
г.
Н.Н. Чакова и др.
 Взаимодействие аллельных вариантов генов симпатоадреналовой...
9. Moore, J.H. New strategies for
Identify
ing gene–gene
Interactions
In hypertension / 
J.H.
Moore, S.W.
Williams // Ann. Med.
– 2002.
Vol.
– P.
10. 
Maron, M.S. Genetics of hypertrophic car
diomyopathy after 20 years: clinical perspectives / 
B.J.
Maron, M.S.
Maron, C.
Semsarian // J.
Am.
Coll. 
Cardiol.
– 2012.
– Vol.
60, № 8.
– P.
705–715.
11.
Seidman, J.G. The genetic basis for cardio
myopathy: from mutation
Identi�cation to mech
anistic paradigms / J.G.
Seidman, C.
Seidman // 
– Vol.
– P.
12. Pinsonneault, J. Pharmacogenomics of mul
tigenic diseases: sex-speci�c differences
In disease 
and treatment outcome / J.
Pinsonneault, W.
Sadée 
// AAPS PharmSci.
– 2003.
– Vol.
5, №
4.
– E
29.
13. The sex-speci�c genetic architecture of qu
antitative traits
In humans / L.A.
Weiss 
al.] // 
Nat Genet.
– 2006.
– Vol.
38, №
– P.
14. Ober, C. Sex-speci�c genetic architecture of 
human disease / C.
Ober, D.A.
Loisel, Y.
Gilad // Nat 
Rev Genet.
– 2008.
– Vol.
9, 
12.
– P.
911–922. 
15. Gender-related differences
In the clinical 
presentation and outcome of hypertrophic cardio
myopathy /
Olivotto [et
al.] // JACC.
– 2005.
Vol.
– P.
16. Heng, O.K. Lack of association of apolipopro
tein E polymorphism with plasma Lp(a) levels
In 
the Chinese / O.K.
Heng, N.
Saha, J.S.
Toy // Clin. 
Genetics.
– 1995.
– Vol.
48, №
3.
– P.
113–119. 
17. Гормональный континуум женского здо
ровья: эволюция сердечно-сосудистого риска 
от менархе до менопаузы / Н.М.
Подзолкова 
др.] // Сердце.
18. Reckelhoff, J.F. Sex steroids, cardiovascular 
disease, and hypertension: unanswered questions 
and some speculations / J.F.
Reckelhoff // Hyper
– Vol.
– P.
19. Lechin, M. Angiotensin-I converting en
zyme genotypes and left ventricular hypertro
phy
In patients with hypertrophic cardiomyopathy 
/ M.
Lechin // Circulation.
– 1995.
– Vol.
P.
20.
The effect of polymorphisms of the angiotensin-
converting enzyme and angiotensinogen genes on 
the phenotypic expression of Spanish patients with 
hypertrophic cardiomyopathy
 / J.
Lopez-Haldon 
[et
al.] // Med. Clin.
– 1999.
– Vol.
113.
– P.
161–163.
.M. Komissarova
ATH
NAL AN
RTR
ATH
Institute of Genetics and Cytology of the National Academy of Sciences of Belarus
Minsk BY-220072, Republic of Belarus
Minsk BY-220036, Belarus
The multifactor-dimensionality reduction (MDR) method was used to identify gene-gene interactions between ge
netic variants in the renin-angiotensin-aldosterone system (
AGT 
1 (1166A>С), 
1 (–1903A>G), 
АСЕ
 (I/D), 
CYP
11
2 (–344С>Т)) and the sympathetic nervous system (
ADRB
1 (Ser49Gly, Arg389Gly), 
ADRB
(Arg16Gly, Gln27Glu) in patients with hypertrophic cardiomyopathy. Gender differences in the interaction of genes 
studied and their different prognostic signi�cance for HCM patients were found. The modeling of these genes inter
genic polymorphisms interactions has been carried out. Combinations of polymorphic loci with the most pathogenetic 
Key words:
 genetic polymorphism, renin-angiotensin-aldosterone system (RAAS), sympathoadrenal system (SAS), 
intergenic interaction.
Дата поступления статьи 9 февраля 2016 г.
Молекулярная и прикладная генетика. Том 20, 2016
г.
УДК 575.174.015.3:616.62-006.6
, Н.В. Никитченко
, Т.Д. Кужир
, С.Л. Поляков
, А.И. Ролевич
Р.И. Гончарова
ОЛИМОРФИЗМ
КСЦИЗИОННОЙ
РЕПАРАЦИИ
ВЛИЯНИЕ
РЕЦИДИВИРОВАНИЕ
РАКА
МОЧЕВОГО
ПУЗЫРЯ
БЕЛОРУССКИХ
ПАЦИЕНТОВ
Институт генетики и цитологии НАН Беларуси
Республика Беларусь, 220072, г. Минск, ул. Академическая, 27; e-mail: [email protected]
РНПЦ онкологии и медицинской радиологии им. Н.Н. Александрова
Республика Беларусь, 223040, Минский р-н, а/г Лесной
Представлены результаты генотипирования образцов ДНК, полученных от пациентов с установленным диа
гнозом рак мочевого пузыря (РМП), по полиморфизму генов эксцизионной репарации нуклеотидов 
312A
sn и Lys751Gln)

ERCC6
 (Met1097Val и Gly399Asp) и оснований
XRCC1 
(A
rg
399G
ln), 
OGG1 
(S
er
326C
ys)
Проанализировано
распределение частот
генотипов и аллелей перечисленных генов у пациентов с первичным 
и рецидивным раком. Обнаружено влияние полиморфизма гена 
 Lys751Gln на рецидивирование РМП в 
группе курящих пациентов. У носителей гетерозиготного генотипа этого гена, курящих 30 и более лет, риск 
развития рецидивов повышался в 3–5 раз при его сочетании с гетерозиготами в других локусах: 
 (ко
дон 399), 
 (кодоны 1097 и 399). Выявлена ассоциация аллеля 
 312Asn с рецидивными опухолями 
высокой степени злокачественности. 
Ключевые слова: 
эксцизионная репарация ДНК; полиморфизм генов 
XPD, XRCC1, OGG1
; рак мо
чевого пузыря, рецидивирование.
Введение
Рак мочевого пузыря (РМП) относится к 
распространенным онкологическим забо
леваниям, ежегодно диагностируется при
мерно у 1200
жителей Республики Беларусь 
и уносит жизни более 400
человек [1]. При
близительно 90%
опухолей мочевого пузыря 
представлены уротелиальной карциномой. 
По клинико-морфологическим признакам 
РМП делится на 2 основные группы: без 
мышечной инвазии (РМП БМИ) и мышечно-
инвазивный (МИ РМП) [2, 3]. Около 75% 
опухолей на момент постановки диагноза 
являются неинвазивными (Ta/T1). Мышечно-
инвазивный рак (T
≥ 2) регистрируется у 25% 
пациентов, которые обычно подвергаются 
цистэктомии и для которых характерен не
благоприятный прогноз: 50%-я смертность 
в течение пяти
лет вследствие прогрессии 
и метастазирования опухоли. У
70–80% 
пациентов с РМП БМИ в течение пяти лет 
развиваются рецидивные опухоли, которые в 
10–20% случаев прогрессируют в мышечно-
инвазивную форму. 
В настоящее время уделяется большое вни
мание разработке критериев, позволяющих 
прогнозировать прогрессию и рецидивирова
ние рака у отдельного пациента. Выбор метода 
лечения и прогнозирование дальнейшего тече
ния РМП базируются на его принадлежности 
к определенной классификационной катего
рии, включающей стадию распространения 
(T) и степень дифференцировки (G) опухоли, 
а также ряд клинических и морфологических 
признаков [4, 5]. Однако отдаленные результа
ты лечения пациентов, относящихся к одним 
и тем же классификационным подгруппам и 
получавших одинаковое лечение, существенно 
различаются. Очевидно, что для полноценного 
прогноза клинического исхода необходима до
полнительная информация, прежде всего, об 
индивидуальных генетически детерминиро
ванных факторах, определяющих как чувстви
тельность клеток и организма к канцерогенезу, 
так и свойства самой опухоли. 
Изучение молекулярной природы РМП при
вело к выделению ключевых мутаций, запу
скающих патогенез заболевания по двум аль
Молекулярная и прикладная генетика. Том 20, 2016
г.
Н.В. Савина и др.
 Полиморфизм генов эксцизионной репарации ДНК: влияние на рецидивирование... 
тернативным путям [6]. Установлена также 
важная роль эпигенетической изменчивости 
некоторых генов [7]. Однако следует учиты
вать вклад в развитие РМП полиморфизма 
генов, участвующих в детоксикации ксено
биотиков и поддержании целостности и ста
бильности генома [8]. Cреди таких
– гены ре
парации ДНК [9]. Ранее нами изучено влияние 
полиморфизма некоторых генов эксцизионной 
репарации ДНК на чувствительность бело
русских пациентов к РМП, а также выявлены 
ассоциации некоторых аллелей полиморфных 
локусов с клинико-патологическими харак
теристиками опухоли [10–13]. Обнаружено, 
что аллельные варианты гена 
XPD
 (кодоны 
312 и 751) ассоциированы с риском развития 
заболевания и степенью злокачественности 
мышечно-инвазивных опухолей. Показана ас
1097 Val/Val генотипа с T ≥ 2 
опухолями, распространяющимися на мышеч
ный слой, подлежащие ткани и органы мало
го таза. Гетерозиготный генотип гена 
OGG1 
(кодон 326), наоборот, снижал риск развития 
РМП и был ассоциирован с неоплазмами с низ
ким злокачественным потенциалом.
Цель данного исследования
– изучить 
влияние полиморфизма генов эксцизионной 
репарации нуклеотидов 
XPD
 (rs1799793, 
rs13181), 
ERCC6
 (rs2228526, rs2228528) и 
эксцизионной репарации оснований 
OGG1
(rs1052133), 
XRCC1
 (rs25487) на рецидиви
рование РМП. Выбор генов обусловлен их 
функциями, и в первую очередь, участием 
соответствующих продуктов в репарации по
вреждений ДНК, вызванных окислительным 
стрессом, который расценивается как важ
нейший фактор инициации и прогрессии рака 
лась конфиденциальность сведений личного 
характера. На каждого пациента оформлялся 
протокол, содержащий такие данные как пол, 
возраст, статус курильщика и длительность 
курения, а также клинические и морфологиче
ские данные, включая макроскопическое и ми
кроскопическое описание опухоли. Стерильно 
взятые образцы цельной крови в количестве 
мл хранились в вакутайнерах с распылен
ным ЭДТА при температуре –20
°С до начала 
молекулярно-генетических исследований.
Объект исследования
– геномная ДНК, вы
деленная из образцов цельной венозной крови 
стандартным фенол-хлороформным методом. 
Анализ полиморфизма генов репарации 
ДНК
XPD
 (rs1799793, rs13181), 
ERCC6
(rs2228526, rs2228528), 
OGG1
 (rs1052133), 
XRCC1
 (rs25487) проводили с помощью по
лимеразной цепной реакции с определени
ем длин рестрикционных фрагментов (ПЦР-
ПДРФ-метод). Праймеры, рестрикционные 
эндонуклеазы, условия и продукты ПЦР под
робно описаны ранее [10–13].
Для статистической обработки данных 
использован пакет стандартных программ 
Microsoft Excel 2000 и Statistica 6. Различия в 
частотах тех или иных генотипов (аллелей), 
так
же, как и
других альтернативных показа
телей, определяли по критерию χ
, тогда как 
для выявления различий по количественным 
признакам применяли 
t-тест
 Стьюдента. Для 
определения вероятности (риска) развития 
рецидивов рака, а также более агрессивного 
течения заболевания вычисляли отношение 
шансов (OR) с доверительным интервалом (CI) 
в соответствии с известными рекомендациями.
Материалы и методы
Группа обследования
состояла из 418
ентов, подлежащих диагностической или ле
чебной трансуретральной резекции мочевого 
пузыря на базе отделения онкоурологической 
патологии РНПЦ онкологии и медицинской 
радиологии им.
Н.Н.
Александрова. Отбор 
биологического материала (периферической 
венозной крови) проводился сотрудниками 
медицинского учреждения после подписания 
участниками исследования информирован
ного согласия; всем участникам гарантирова
Результаты и обсуждение
Характеристика группы пациентов с гисто
логически установленным РМП 
представлена 
в табл.
1. Эта группа состояла преимуществен
но из мужчин (82%) и пожилых людей (сред
ний и медианный возраст
– 67
лет). Курящие 
составляли 68% выборки. Эти особенности 
укладывались в известную демографическую 
картину РМП как болезни, зависимой от воз
раста, пола и курения [16].
По данным морфологического и гистологи
ческого исследования удаленных при трансу
ретральной резекции опухолей, наиболее ча
сто выявлялась уротелиальная карцинома Ta/
Молекулярная и прикладная генетика. Том 20, 2016
г.
Н.В. Савина и др.
 Полиморфизм генов эксцизионной репарации ДНК: влияние на рецидивирование... 
T1 (около 70%); опухоли T2 составляли 17%; 
T3/T4
– 13%. По степени дифференцировки 
опухолей, в соответствии с классификацией 
1973
г., 33% относились к G1, 45%
– G2 и чуть 
более 20%
– G3. В соответствии с классифи
кацией 2004
г., 58% были представлены low 
grade, а 37%
– high grade опухолями. CIS (кар
цинома 
in situ
) занимала 0,2%; в 0,4% случа
ев не указана стадия T и в 1,4–2,2%
– степень 
дифференцировки и злокачественности опу
холевой ткани (G, low/high grade). Рецидивы 
РМП встречались примерно в 36% случаев.
Таким образом, в данной проспективной когор
те пациентов, насчитывающей 418 человек, наи
более часто диагностировались опухоли на стадии 
T1 G1–G2 (высоко- и умеренно дифференциро
ванный рак без мышечной инвазии). Однако поч
ти у трети пациентов выявлены опухоли на ста
дии T2–T4 (мышечно-инвазивный рак и опухоль, 
распространяющаяся на околопузырные ткани 
и органы малого таза), что свидетельствовало 
о необходимости совершенствования методов 
ранней диагностики и прогноза клинического 
течения заболевания.
Таблица 1
Характеристика группы пациентов с установленным диагнозом РМП; 
клинико-морфологические параметры опухоли
Частота, %
Пол
Мужской
женский
Возраст (лет)
Курение
Курит
Не курит
117
Стадия 
опухоли
Ta
Степень 
11
опухоли
Рецидивные
Молекулярная и прикладная генетика. Том 20, 2016
г.
Н.В. Савина и др.
 Полиморфизм генов эксцизионной репарации ДНК: влияние на рецидивирование... 
Анализ полиморфизма генов репарации 
ДНК OGG1, XRCC1, XPD и ERCC6 при пер
вичных и рецидивных опухолях.
 Функцио
нальная характеристика генов и описание 
аллельных вариантов дана в предыдущих 
публикациях [10–13]. Результаты генотипи
рования представлены в
табл.
2. Установлено, 
что генотипы по всем изученным вариантам 
распределены одинаково в группах пациен
тов с первичными и рецидивными опухоля
ми. При учете таких этиологически важных 
факторов, как пол и курение, не обнаружено 
существенных различий между первичными 
и рецидивными опухолями у мужчин, тогда 
как у курящих пациентов с рецидивами РМП 
частоты гомозигот дикого типа и гетерозигот 
по гену 
XPD 
(кодон
751) существенно отли
чались от этих показателей при первичных 
опухолях. Вероятность появления рецидивов 
на фоне гетерозиготного генотипа 
XPD
 751 
Lys/Gln почти удваивалась (OR [95%IC]
1,77 [1,07–2,94]
 P
=
0,026). Суммарная часто
та генотипов, содержащих вариант XPD 751 
Gln, у пациентов с рецидивными опухолями 
также оказалась существенно выше: 80,4% по 
сравнению с 68% при первичных опухолях 
=
0,028) (данные представлены на рис.
1). 
Сходные, но статистически не доказанные 
ассоциации отмечены для полиморфизма 
XRCC1
 Arg
399Gln. У носителей гетерози
готных комбинаций по этим двум локусам 
выражена тенденция к увеличению риска раз
вития рецидивных опухолей: OR [95%IC]
1,69 [0,99–2,91] (
=
0,055).
Таблица 2
Распределение генотипов по изученным генам репарации ДНК у пациентов с первичными 
рецидивными опухолями
Генотипы
РМП (вся выборка)
Пол (мужчины)
Курение (вся выборка)
Рецидивные
Рецидивные
Рецидивные
Ser/Ser, %
Arg/Arg, %
Arg/Gln, %
11,2
11,3
11,6
 115
Lys/Lys, %
Lys/Gln, %
ERCC
 1097
Met/Val, %
Молекулярная и прикладная генетика. Том 20, 2016
г.
Н.В. Савина и др.
 Полиморфизм генов эксцизионной репарации ДНК: влияние на рецидивирование... 
Генотипы
РМП (вся выборка)
Пол (мужчины)
Курение (вся выборка)
Рецидивные
Рецидивные
Рецидивные
Val/Val, %
 118
Gly/Gly, %
Продолжение табл. 2
Примечание.
Существенные различия между группами курящих пациентов с первичными и рецидивными опухолями 
 0,028 для гомозигот дикого типа и
 0,025 для гетерозигот по локусу rs13181.
Результаты дальнейшего исследования эф
фектов продолжительного курения на ре
цидивирование РМП на фоне тех или иных 
изученных генотипов показаны на рис.
2. У па
циентов, курящих 30 и более лет, как и во всей 
группе курящих, наблюдались существенные 
различия между рецидивными и первичными 
опухолями по гену 
XPD
 (кодон
751), и сходная 
тенденция намечалась по гену 
(кодон 
Рис. 1. 
Распределение генотипов по генам 
(кодон 751) и 
 (кодон 399) у курящих пациентов 
с первичными и рецидивными опухолями
Рис. 2. 
Распределение некоторых генотипов и их комбинаций у пациентов с первичными и рецидивными 
опухолями при курении более 30 лет: а
– частоты генотипов
XPD
 Lys751Gln и 
XRСС1
 Arg399Gln; б
– комбинации 
гетерозигот 
XPD
 751 Lys/Gln, 
XRСС1
399 Arg/Gln, 
ERCC6
 1097Met/Val, 
ERCC6
399 Gly/Asp
Молекулярная и прикладная генетика. Том 20, 2016
г.
Н.В. Савина и др.
 Полиморфизм генов эксцизионной репарации ДНК: влияние на рецидивирование... 
Характерно, что комбинация, содержащая 
гетерозиготы по этим двум локусам (рис.
2 б), 
была ассоциирована с рецидивными опухо
лями при OR [95%CI]
 2,15 [1,14–4,05] (
0,018)
– для Lys/Gln Arg/Gln. Значение OR 
значительно увеличивалось при сочетании 
этой комбинации с гетерозиготой 
ERCC6
 1097 
Met/Val: OR [95%CI]
 2,92 [1,18–7,23] (
– для Lys/Gln Arg/Gln Met/Val, и особен
– с гетерозиготой 
399 Gly/Asp: OR 
 5,09 [1,53–16,91] (
 0,008)
– для 
Lys/Gln Arg/Gln Gly/Asp. Данные позволяют 
предположить, что полиморфизм гена 
ERCC6
который сам по себе не связан с рецидивными 
опухолями (в том числе и при курении), может 
увеличивать вероятность появления рециди
вов у носителей двух других гетерозигот, ку
рящих 30 и более лет.
Подтверждено определяющее влияние ге
терозиготы 
 751 Lys/Gln на опухолеобра
зование в мочевом пузыре, которое проявля
лось не только в отношении инициации рака 
[13], но и возникновения рецидивов, как во 
всей группе курящих пациентов, так и при 
длительном (≥ 30 лет) курении. Рисковая зна
чимость этого генотипа повышалась при его 
комбинации с гетерозиготами по некоторым 
другим локусам. 
Распределение аллельных вариантов генов 
эксцизионной репарации ДНК у пациентов с 
первичными и рецидивными опухолями в зави
симости от их распространенности и степени 
злокачественности.
 Принципиальное значение 
для прогноза имеет стадия заболевания, которая 
определяется в соответствии с международной 
системой TNM (Tumor, Nodulus, Metastasis). 
По этой классификации различают опухоли 
Ta (неинвазивная папиллярная карцинома), Т1 
(опухоль распространяется на субэпителиаль
ную соединительную ткань), T2 (опухолевая 
инвазия мышечного слоя), T3 (опухоль распро
страняется на паравезикальную клетчатку), T4 
(опухоль распространяется на органы малого 
таза) [2]. Стадии Ta/T1 характеризуют РМП 
БМИ, тогда как стадии T ≥ 2 свойственны ин
вазивному раку. Дифференциация опухолевой 
ткани отражает степень ее злокачественности. 
По классификации ВОЗ 1973 г., различают 3 
степени (G1, G2, G3), соответствующие высо
ко-, умеренно- и низкодифференцированным 
карциномам [2]. По классификации 2004 г., 
уротелиальные карциномы делятся на папил
лярные опухоли с низким злокачественным по
тенциалом (PNLMP), опухоли низкой степени 
злокачественности (low grade), в категорию ко
торых попадают все G1 и частично G2, и опу
холи высокой степени злокачественности (high 
grade), поглощающие все G3 и частично G2 [2]. 
Мы проанализировали распределение геноти
пов/аллелей изученных генов в зависимости 
от этих категорий отдельно при первичных и 
рецидивных опухолях. 
У пациентов с первичным РМП, так же, как 
и во всей выборке [13], существенные раз
личия относительно инвазивности опухоли 
найдены только по гену 
1097: частота 
гомозигот по варианту 
ERCC6
1097Val при 
опухолях Т
≥ 2 (12,9%) в 3
раза превосходила 
их частоту (4,2%) при неоплазмах Та/T1 (
0,008). При стратификации выборки пациен
тов с первичным РМП на категории Ta/T1 low 
grade, Ta/T1 high grade, T ≥ 2 low grade и T ≥ 2 
high grade подтверждена рисковая значимость 
гомозиготного генотипа 
1097 Val/Val, 
частота которого составляла 12,3% у пациен
тов с МИ РМП высокой степени злокачествен
ности и 4,6%
– при РМП БМИ низкой степени 
злокачественности (
 0,037). Частота этого 
же генотипа была выше (но статистически 
не значимо) у пациентов с рецидивами РМП: 
11,5% при инвазивных опухолях и 5,8% при 
РМП БМИ, соответственно. Возможно, наблю
даемые в этом случае различия не достигли 
статистической значимости из-за размера вы
пациентов).
У пациентов с рецидивными опухолями 
гетерозиготы и генотипы, содержащие хотя 
бы один аллель 
XPD
 312Asn, превалирова
ли при высокой степени злокачественности 
(47,4% и 73,7%, соответственно) по сравне
нию с неоплазмами низкой степени злокаче
ственности (27,7% и 49,2%, соответственно). 
Рис.
3 демонстрирует статистически значимые 
различия между low и high grade опухолями, 
касающиеся гена 
 (кодон 312), и сходные 
тенденции относительно другого полиморфно
го локуса этого гена (кодон 751), а также гена 
 (кодон 326). 
Таким образом, вариант гена 
ERCC6 
1097Val 
в гомозиготном состоянии влиял на инвазив
ность и степень злокачественности первичных 
Молекулярная и прикладная генетика. Том 20, 2016
г.
Н.В. Савина и др.
 Полиморфизм генов эксцизионной репарации ДНК: влияние на рецидивирование... 
опухолей: OR [95%CI]
 3,40 [1,31–8,83]
 P
0,012) при Т ≥ 2 по сравнению с Та/T1; OR 
 2,93 [1,02–8,41]
 0,045) при Т ≥ 
2 high grade по сравнению с Та/T1 low grade 
карциномами. Наличие полиморфного ал
леля Asn увеличивало вероятность развития 
рецидивных опухолей высокой степени зло
качественности (high grade) по сравнению с 
опухолями низкой степени злокачественности 
(low grade): OR [95%CI]
 2,35 [1,02–5,43] (
0,045) для гетерозиготного генотипа 
Asp/Asn и OR [95%CI]
 1,83 [1,03–3,25] (
0,040) для варианта
Влияние полиморфных вариантов некото
рых генов эксцизионной репарации ДНК на 
клиническое течение рака мочевого пузыря.
Ранее упоминалось, что существуют мутации, 
запускающие опухолевый процесс по альтер
нативным путям патогенеза. Обнаружено, что 
активирующие мутации в гене 
приво
дят к развитию РМП без мышечной инвазии, 
тогда как мутации гена-супрессора 
– к 
мышечно-инвазивному раку. Однако значи
тельная часть опухолей (38%) имеет «дикий» 
генотип по этим мутациям, и, следовательно, 
может развиваться по иному молекулярно-
генетическому пути [17]. С помощью полно
геномного секвенирования установлена роль 
в развитии РМП мутационной изменчивости 
некоторых других генов (
RB1

PIK3CA, KRAS, 
HRAS, NRAS, CDKN2A, TSC1
) [18]. Известно 
Рис. 3.
 Распределение генотипов/аллелей у пациентов с рецидивными опухолями в зависимости от дифференциа
ции и степени злокачественности опухолевой ткани: а
– частота гетерозигот XPD 312 Asp/Asn составляла 47,4% 
при низкодифференцированных (high grade) и 27,7% при высокодифференцированных (low grade) опухолях: OR 
[95%CI]   2,35 [1,02–5,43] (
 0,045); б
– аллель XPD 312Asn при high grade опухолях встречался с частотой 50%, 
тогда как при low grade неоплазмах его частота составляла 35,4%: OR [95%CI]   1,83 [1,03–3,25] (
 0,040).
Частоты аллеля XPD 751Gln составляли 51,4% и 41,4%, а OGG1 326Cys – 25,0% и 16,2%, соответственно
об определенном вкладе эпигенетической из
менчивости в патогенез этого заболевания [7], 
что подтверждается высокой частотой мети
лирования промоторной области гена 
при РМП, а также наличием обратной корре
ляции между статусом метилирования этого 
гена и мутационной изменчивостью 
FGFR3
при отсутствии ассоциации с частотой мута
ций в гене 
TP53
 [19]. Кроме того, показано, 
что эпигенетическая изменчивость 
RUNX3
является независимым фактором риска в от
ношении прогрессирования и онкоспецифи
ческой выживаемости пациентов с РМП без 
мышечной инвазии. 
В отличие от известных ключевых мута
ций, генетический полиморфизм не оказы
вает столь значительного и специфического 
действия на процесс канцерогенеза. Однако 
его существенная роль в онкопатологии до
казывается многочисленными работами, в 
том числе и широкогеномным исследованием 
(GWAS), в ходе которого идентифицировано 
более 300 доказанных ассоциаций между гене
тическими вариациями и 70 общими болезня
ми [8]. Следует отметить, что функции генов, 
имеющих отношение к раку мочевого пузыря, 
сфокусированы на детоксикации ксенобиоти
ков, сохранении целостности и стабильности 
генома, контроле клеточного деления и апоп
тоза. Целостность и стабильность генома 
поддерживаются системами репарации ДНК 
и зависят от эффективности и точности этого 
Молекулярная и прикладная генетика. Том 20, 2016
г.
Н.В. Савина и др.
 Полиморфизм генов эксцизионной репарации ДНК: влияние на рецидивирование... 
процесса. Поэтому изменчивость в полиморф
ных локусах генов эксцизионной репарации в 
связи с канцерогенезом и, в частности, с уроте
лиальной карциномой, представляет научный 
и практический интерес.
Наши предыдущие результаты подтвержда
ют влияние полиморфизма генов 
ERCC2/XPD
 на инициацию и прогрес
сирование РМП [10–13]. Модификация функ
ций и/или активности этих генов сказывается и 
на рецидивировании рака. Отмечается, что все 
известные однонуклеотидные замены (SNP) 
ассоциированы с онкологическими заболе
ваниями при отношении шансов не более 1,5 
[8], что характерно и для наших исследований. 
Однако, взаимодействуя друг с другом, они 
могут повышать риск развития РМП, и, по-
видимому, изменять его клиническое течение. 
Так, гетерозиготное носительство минорных 
аллелей гена 
 (кодоны 1097 и 399) 
существенно не влияло на рецидивирование 
РМП. Однако сочетание этих гетерозигот с 
комбинацией гетерозиготных генотипов 
ER
CC2/XPD
 751 Lys/Gln и 
XRCC1
399 Arg/Gln на 
фоне длительного курения увеличивало риск 
развития рецидивов в 3–5 раз. 
Изучение прогностической значимости по
лиморфизма генов репарации ДНК другими 
авторами привело к неоднозначным (зачастую 
противоположным) результатам. При исследо
вании этой проблемы в связи с эффективно
стью химиотерапии и выживаемостью пациен
тов показано, что варианты генов 
XPD
 751Gln, 
XRCC1
399Gln, 
OGG1
326Cys при опреде
ленных условиях улучшают эти показатели 
[20–24]. Однако анализ генетического поли
морфизма в связи с клинико-патологическими 
параметрами выявил повышение частоты ре
цидивов РМП у пациентов-носителей хотя бы 
одного аллеля 
 1097Val [25] и влияние 
полиморфизма гена 
APE1
 на инвазивность 
опухоли при нейтральности других изучен
ных вариантов (
XRCC1, XRCC3, XPD, XPG, 
hOGG1
) [26]. Сравнение наших результатов 
с данными литературы позволяет предполо
жить, что изменение репарационных функций 
благодаря полиморфизму генов эксцизионной 
репарации ДНК, с одной стороны, повышает 
чувствительность опухолевых клеток к хи
мио- или радиотерапии, но с другой,
– может 
способствовать агрессивности РМП. 
Полученные результаты дают основание 
полагать, что, хотя варианты изученных ге
нов эксцизионной репарации ДНК не отно
сятся к мутациям, ответственным за молеку
лярный патогенез РМП, они модифицируют 
риск развития и клиническое течение рака. 
Подтверждена целесообразность изучения 
полиморфизма этих генов в связи с клинико-
патологическими параметрами опухолей для 
выявления дополнительных прогностических 
маркеров. К таковым можно отнести вари
анты 
ERCC6/CSB 
Met1097Val, 
ERCC2
XPD
Lys751Asp, преиму
щественно ассоциированные с распространен
ностью опухоли, степенью дифференциации 
опухолевой ткани и/или рецидивированием 
рака. Следует также обратить внимание на 
взаимодействие генов, которое в некоторых 
случаях существенно увеличивает рисковую 
значимость отдельных SNP. Чтобы повысить 
практическую ценность выявленных марке
ров, целесообразно в будущем оценить их 
влияние на такие медицинские показатели как 
общая и онкоспецифическая выживаемость, 
выживаемость до прогрессирования и безре
цидивная выживаемость пациентов, страдаю
Заключение
Генотипировано 418
образцов ДНК от паци
ентов с гистологически установленным раком 
мочевого пузыря (РМП) и проанализировано 
распределение частот генотипов и аллелей 
генов эксцизионной репарации 
ERCC2
XPD 
sn и Lys751Gln)
 (Met
1097Val и Gly399Asp), 
XRCC1 
(A
rg
399G
ln), 
OGG1 
(S
er
326C
ys) в зависимости от клинико-
патологических и этиологических факторов. 
Рецидивные опухоли наблюдались у 36% па
циентов. Выявлены статистически значимые 
различия между группами курящих пациентов 
с рецидивными и первичными опухолями по 
полиморфизму гена 
XPD
751. У пациентов, 
курящих 30 и более лет, вероятность разви
тия рецидивных опухолей значимо повыша
лась под влиянием гетерозиготного генотипа 
XPD
751 Lys/Gln и увеличивалась в 3–5
раз при 
сочетании этого генотипа с гетерозиготами в 
других изученных локусах (
XRCC1 
rg
399G
ln, 
ERCC6 
Met1097Val, 
ERCC6
 Gly399Asp). Уста
новлена ассоциация аллеля 
XPD
 312Asn и 
Молекулярная и прикладная генетика. Том 20, 2016
г.
Н.В. Савина и др.
 Полиморфизм генов эксцизионной репарации ДНК: влияние на рецидивирование... 
Полиморфизмы генов эксцизионной 
репарации ДНК при раке мочевого пузыря 
/ Н.В.
Савина [и др.] // Молекулярная и 
прикладная генетика: сб. науч. тр.
– 2011.
Т.
10.
Полиморфизм генов эксцизионной репа-
рации 
XPD

XRCC1
 и
hOGG1
 у
населения Рес-
публики Беларусь и его влияние на канцерогенез 
/ О.П.
Романюк [и
др.] // Экологическая 
генетика.
– 2013.
– Т.
11, №
4.
– С.
45–63.
11.
Polymorphism of DNA repair genes 
OGG1, XRCC1, XPD
, and 
in bladder 
cancer in Belarus / V.P.
Ramaniuk [et
al.] // Bio
– Vol.
– P.
Полиморфизм генов эксцизионной репа-
рации ДНК как дополнительный фактор про-
грессии рака мочевого пузыря: исследование 
на пациентах Беларуси / Н.В.
Савина [и
др.] 
// Молекулярная и прикладная генетика: сб. 
науч. тр.
– Т.
The cellular response to oxidatively induced 
DNA damage and polymorphism of some DNA 
repair genes associated with clinicopathological 
features of bladder cancer / N.V.
Savina [et
Oxidative Medicine and Cellular Longevity.
2016: 5710403. doi 10.1155/2016/5710403
Klaunig, J.E. Oxidative stress and oxida
tive damage in carcinogenesis / J.E. Klaunig, 
L.M. Kamendulis, B.A. Hocevar // Toxicol. 
– Vol.
– P.
The role of oxidative stress in bladder 
cancer / E.
Sawicka [et
al.] // Postepy Hig Med 
– Vol.
– P.
Janković, S. Risk factors for bladder can
cer / S.
Janković, V.
Radosavljević // Tumori.
– Vol.
– P.
FGFR3 and TP53 mutations in a prospec
tive cohort of Belarusian bladder cancer patients 
/ M.P.
Smal [et
al.] // Exp. Oncol.
– 2014.
Vol
– P.
Combined gene expression and genomic 
pro�ling de�ne two intrinsic molecular subtypes 
of urothelial carcinoma and gene signatures for 
molecular grading and outcome / D.
Vol.
P.
Статус метилирования гена 
 как 
фактор прогноза при раке мочевого пузыря 
без мышечной инвазии / М.П.
Смаль [и
// Доклады НАН Беларуси.
– 2015. – T. 59, 
гетерозиготного генотипа 
XPD
312 Asp/Asn 
с риском развития рецидивных опухолей вы
сокой степени злокачественности. В отличие 
от полиморфных вариантов гена 
XPD
, ми
норный аллель 
ERCC6
1097Val в гомозигот
ном состоянии ассоциирован с первичными 
мышечно-инвазивными опухолями высокой 
степени злокачественности. Указанные ассо
циации свидетельствуют о возможном влия
нии изученных аллельных вариантов генов 
эксцизионной репарации ДНК (отдельно и при 
их взаимодействии с этиологически важным 
фактором или между собой) на рецидивирова
ние и более агрессивное течение РМП.
Список использованных источников
Океанов, А.Е. Статистика онкологичес-
ких заболеваний / А.Е. Океанов, П.И.
Моисеев, 
Левин; под ред. О.Г. Суконко.
– Минск, 
Рак мочевого пузыря TaT1 (без мышеч-
ной инвазии) / M.
Babjuk [et
al.]; пер.
дянина, науч. ред. О.Б.
Карякин.
– Европейская 
ассоциация урологов, 2010.
Инвазивный и метастатический рак
мочевого пузыря / A.
Stenzl [et
al.]; пер.
тонова, науч. ред. И.Г.
Русаков
– Европейская 
ассоциация урологов, 2010.
Predicting recurrence and progression 
in individual patients with stage TaT1 bladder 
cancer using EORTC risk tables: a combined 
analysis of 2596 patients from seven EORTC tri
als / R.J.
Sylvester [et
al.] // Eur Urol.
Vol.
P.
5.
Ather, M.H. Predicting recurrence and pro
gression in non-muscle-invasive bladder cancer 
using European organization of research and treat
ment of cancer risk tables / M.H.
Ather, M.
Zaidi 
// Urol.
J.
– 2009.
– Vol.
6, №
3. – P.
189–193.
FGFR3 and P53 characterize alternative 
genetic pathways in the pathogenesis of urothelial 
cell carcinoma / B.W.
Rhijn [et
al.] // Cancer 
– Vol.
– P.
1911–1914.
Kim, Y.K. Epigenetic markers as prom
ising prognosticators for bladder cancer / 
Y.K.
Kim, W.J.
Kim // Int. J.
– 2009.
Vol.
– P.
Genetic variants in urinary bladder cancer: 
collective power of the “wimp SNPs” / K.
ka [et
al.] // Arch. Toxicol.
– 2011.
– Vol.
– P.
Молекулярная и прикладная генетика. Том 20, 2016
г.
Н.В. Савина и др.
 Полиморфизм генов эксцизионной репарации ДНК: влияние на рецидивирование... 
20.
Single nucleotide polymorphisms in DNA 
repair genes might be prognostic factors in mus
cle-invasive bladder cancer patients treated with 
chemoradiotherapy / S.
Sakano [et
al.] // Br.
J.
Can
cer.
– 2006.
– Vol.
95, No.
5.
– P.
561–570.
DNA repair gene polymorphisms may be 
associated with prognosis of upper urinary tract 
transitional cell carcinoma / M. Sasaki [et
al.] // 
– Vol.
– P.
22.
Polymorphisms in 
XPD

XPC
 and the risk of 
death in patients with urinary bladder neoplasms / 
S.
Sanyal [et
al.] // Acta Oncol.
– 2007.
– Vol.
46.
P.
31–41. 
Polymorphisms in the 
 gene mod
ify survival of bladder cancer patients treated 
with chemotherapy / C.
Sacerdote [et
al.] // 
Cancer.
– 2013
– Vol.
– P.
Tissue hOGG1 genotype predicts blad
der cancer prognosis: a novel approach using a 
peptide nucleic acid clamping method / Y.S.
al.] // Ann. Surg. Oncol.
– 2011.
– Vol.
P.
Nucleotide excision repair gene polymor
phisms and recurrence after treatment for super
�cial bladder cancer / J.
Gu [et
al.] // Clin. Can
– Vol.
11.
– P.
Bladder cancer and polymorphisms of 
DNA repair genes (
XRCC1, XRCC3, XPD, XPG, 
APE1, hOGG1
) / K
F.
Narter [et
al.] // Antican
–Vol.
– P.
.V. 
.V. 
Goncharova
ACT 
AN PAT
Institute of Genetics and Cytology of the National Academy of Sciences of Belarus
Minsk BY-220072, Republic of Belarus
N.N. Alexandrov National Cancer Centre of Belarus
Lesnoy, Minsk District BY-223040, Republic of Belarus
The results of genotyping DNA samples collected from patients with veri�ed diagnosis of bladder cancer (BC) 
for polymorphism of nucleotide excision repair genes 
 (Asp312Asn and Lys751Gln), 
 (Met1097Val and 
Gly399Asp) and base excision repair genes 
 (Arg399Gln), 
 (Ser326Cys) are presented. The distribution 
of genotypic/allelic frequencies for the listed genes has been analyzed in patients with primer and recurrent tumors. 
The impact of the 
 Lys751Gln polymorphism on cancer recurrence was found in smokers. In 
 Lys751Gln 
heterozygous genotype carriers smoking over 30 years, the recurrence risk was increased in 3–5 times by combining 
that with heterozygotes in other loci (
XRCC1
 399, 
ERCC6
 1097 and 399). The association between 
XPD
 312Asn allele 
Key words: 
DNA excision repair, 
 gene polymorphisms, bladder cancer, recurrence.
Дата поступления статьи 8 декабря 2015 г.
Молекулярная и прикладная генетика. Том 20, 2016
г.
УДК 575.174.015.3:616-036.11
О.Д. Левданский
, М.С. Родькин
, Д.Е. Данилов
, В.С. Панкратов
Около-Кулак
А.В. Троян
, И.А. Карпов
, О.Г. Давыденко
ОЛИМОРФИЗМ
ГЕНОВ
L28
TN
СРЕДИ
КОРЕННОГО
НАСЕЛЕНИЯ
 Б
ЕЛАРУСИ

ТАК
ПАЦИЕНТОВ
ХРОНИЧЕСКИМ
ГЕПАТИТОМ 
Институт генетики и цитологии НАН Беларуси; e-mail: [email protected]
Республика Беларусь, 220072, г. Минск, ул. Академическая, 27
Белорусский государственный медицинский университет
Республика Беларусь, 220116, г. Минск, пр-т Дзержинского, 83
Белорусский государственный университет
220030, Республика Беларусь, г. Минск, пр-т Независимости, 4
Было проанализировано распределение генотипов
IL28B
 и 
TNF-
α среди этнических белорусов из шести 
этногеографических регионов, а также у пациентов с хроническим гепатитом
С. Полученные распределения 
частот для гена 
 незначительно различались между регионами, в то время как для гена 
-α было вы
явлено отличие юго-западного региона от северного и центрального. Показано, что среди пациентов генотипы 
CT и TT, а также аллель T гена 
 встречаются достоверно чаще, чем у коренных белорусов.
Ключевые слова:
-α, белорусы, хронический гепатит
Введение
Вирус гепатита
С является одной из наибо
лее распространенных причин развития хро
нических заболеваний печени, включая цирроз 
и онкологические заболевания. По некоторым 
данным, около 2%
населения мира страдает от 
хронического гепатита
С [1], что обуславли
вает высокую значимость исследования фак
торов, влияющих на вероятность спонтанной 
элиминации вируса, а также эффективности 
применения различных лекарственных пре
паратов и их комбинаций, назначаемых при 
терапии данного заболевания.
Как показывают исследования, полиморф
ный локус rs12979860 в гене 
, кодирую
щем интерферон лямбда-3, представляет собой 
важный предиктор как спонтанной элими
нации вируса, так и эффективности терапии 
пегилированным интерфероном в сочетании 
с рибавирином [2–4]
В настоящее время ал
лельное состояние гена 
 является одним 
из важнейших критериев при назначении ин
терферонотерапии пациентам с хроническим 
вирусным гепатитом
Ген 
IL28B
 картирован на длинном плече 
19
хромосомы (19p13.13). Было показано, 
что замена C на T (rs12979860) в нетрансли
руемой области гена не оказывает прямого 
воздействия на его экспрессию. Позже был 
обнаружен полиморфный локус ss469415590 
(TT/ΔG), в значительной степени сцепленный 
с rs12979860. Замена двух ТТ на G в данной 
позиции приводит к возникновению новой 
рамки считывания (
IFNL4
) и таким образом 
оказывает влияние на экспрессию 
IL28B
. Наи
большая степень сцепления данных локусов 
описана для представителей азиатских, а так
же европейских этносов [6]. Выявление частот 
встречаемости аллельных состояний по локусу 
rs12979860 в различных, в том числе этниче
ских популяциях, может объяснять отличия в 
эффективности лечения среди европейских, 
африканских и азиатских пациентов [7, 8].
Несмотря на весомый вклад полиморфизма 
гена 
IL28B
, продолжается поиск дополнитель
ных предикторов эффективности терапии хро
нического гепатита
С. В частности, одним из 
генов-кандидатов является ген 
TNF
-α. Данный 
ген картирован на хромосоме 6p21.3 и коди
рует цитокин фактор некроза опухолей альфа. 
Однонуклеотидная замена -308
G/A 
(rs1800629) 
в промоторной области способна приводить к 
значительному возрастанию уровня экспрес
-α. В ряде исследований было проде
Молекулярная и прикладная генетика. Том 20, 2016
г.
О.Д. Левданский и др. 
Полиморфизм генов 
-α среди коренного населения Беларуси... 
монстрировано влияние полиморфного локуса 
rs1800629 на эффективность терапии хрониче
ского гепатита
С [9], а также на вероятность 
спонтанной элиминации вируса [10].
В рамках данной работы был проанализиро
ван полиморфизм генов 
IL28B
 (rs12979860) и 
TNF
-α (rs1800629) среди этнических белору
сов из шести этногеографических регионов, а 
также у пациентов с хроническим гепатитом
С.
ной 136, 77 и 25
п.н., при наличии аллеля
161 и 77
п.н. Размер рестрикционных фраг
ментов определялся путем их разделения в 
8%-ном
полиакриламидном геле. 
Генотипирование по локусу rs1800629 ге
на 
TNF
-α также осуществлялось методом 
ПЦР-ПДРФ-анализа. Объем ПЦР-смеси на 
образец составлял 15
мкл, смесь включа
ла в себя следующие компоненты: 1х
фер для ДНК-полимеразы 
Taq
 без MgCl
по 0,25
мМ каждого из 4
дезоксириботри
фосфатнуклеотидов; 1,5
мМ MgCl
; по 
0,5
мкМ каждого из двух праймеров (F-5’-
AGGCAATAGGTTTTGAGGGCCAT-3’, R-5’-
TCCTCCCTGCTCCGATTCCG-3’); 0,07
ед./
мкл ДНК-полимеразы 
Taq
. ПЦР осуществля
лась по следующей программе: 95
°С в течение 
мин; 31
цикл, каждый из которых включал 
денатурацию при 95
°С в течение 30
с, отжиг 
праймеров
– 40
с при 58
°С, 40
с элонгации 
при 72
°С; финальная элонгация при 72
мин. Размер амплифицированного продук
та
– 108
п.н. Инкубирование ампликонов с 
рестриктазой 
NcoI
 проводилось при 37
°С в 
течение 16
ч. Размер рестрикционных фраг
ментов определялся путем их разделения в 
8%-ном полиакриламидном геле. При нали
чии аллеля
A после рестрикции образуются 
фрагменты длинной 87 и 20
п.н., при наличии 
аллеля
G остается один фрагмент размером 
107
п.н. Присутствие на электрофореграмме 
фрагментов всех перечисленных размеров сви
детельствовало о гетерозиготности.
Статистический анализ проводился с ис
пользованием программного пакета MS Ex
Материалы и методы
В исследовании использовались образцы 
тотальной ДНК 106
пациентов с диагностиро
ванным хроническим вирусным гепатитом
генотип), а также 390
образцов этнических 
белорусов. В выборку этнических белорусов 
включались представители мужского пола, ко
ренные жители в третьем поколении из пяти 
этногеографических регионов Беларуси, не 
состоящие в близком родстве.
Генотипирование по локусу rs12979860 
гена 
IL28B
 проводилось методом ПЦР-
ПДРФ-анализа с использованием рестрик
тазы 
Bsh1236I
. Объем ПЦР-смеси составлял 
15
мкл, состав смеси был следующим: 1х 
буфер для ДНК-полимеразы 
Taq
 без MgCl
(Праймтех), по 0,25
мМ каждого из 4
дезок
сириботрифосфатнуклеотидов, 1,3
мМ Mg
Cl
, по 0,4
мкМ каждого из двух праймеров 
(F-5’-CGCTTATCGCATACGGCTAGG-3’ и 
R-5’-CAGGGTCAATCACAGAAGGGAG-3’), 
0,07
ед./мкл ДНК-полимеразы 
Taq
. Ампли
фикация включала в себя следующие стадии: 
мин при 95
°С, затем 36
циклов, каждый из 
которых состоял из денатурации при 95
°С в 
течение 30
с, отжига праймеров при 60
20
с и элонгации при 72
°С в течение 30
с, 
после чего следовала финальная элонгация 
при 72
– 3
мин. Инкубирование продуктов 
амплификации с рестриктазой 
 про
водилось при 37
°С в течение 16
В результате ПЦР амплифицировался фраг
мент ДНК размером в 238
п.н. Замена С на
в локусе rs12979860 приводит к исчезновению 
сайта узнавания рестриктазы 
Bsh1236I
. Кроме 
того, амплифицируемый фрагмент содержал 
дополнительный инвариантный сайт узнава
ния данной рестриктазы, который использо
вался как внутренний контроль рестрикции. 
Таким образом, при наличии аллеля
С после 
рестрикции образовывались фрагменты дли
Результаты и обсуждение
Аллельное состояние гена
IL28B
 было опре
делено у 390 этнических белорусов. Гено
CC был выявлен у 169 из них, что соста
вило 43,3% общей выборки. Гетерозиготный 
генотип
CT был обнаружен у 170 индивидов 
(43,6%), носителями аллеля
T в гомозигот
ном состоянии оказались 51 человек (13,1%). 
Распределение генотипов не
противоречило 
закону Харди-Вайнберга (
 0,1). Частота 
аллеля
T составила 34,9%.
Помимо этнических белорусов, генотип
локусу rs12979860 гена 
IL28B
 был также опре
делен у 106 пациентов с диагностированным 
Молекулярная и прикладная генетика. Том 20, 2016
г.
О.Д. Левданский и др. 
Полиморфизм генов 
-α среди коренного населения Беларуси... 
хроническим гепатитом
С. Генотип
СС был 
выявлен среди них у 20 индивидов (18,9%), 
генотип
– у 61 (57,5%), а носителями ге
нотипа
ТТ оказались 25 человек (23,6%). Вы
явленная частота аллеля
Т составила 52,4%. 
Распределение генотипов
соответствовало 
закону Харди-Вайнберга (
 0,11). Для более 
наглядного сравнения полученные частоты и 
соответствующие показатели, выявленные у 
этнических белорусов, представлены на рис.
1.
Из рисунка видно, что аллель
Т, равно как 
и содержащие его генотипы, со значительно 
большей частотой представлен среди паци
ентов с хроническим гепатитом
С. Так, в рас
пределении генотипов
в группе пациентов за
метно преобладали носители сочетаний CT и 
TT и с гораздо меньшей частотой встречались 
индивиды с генотипом CC (
< 0,001). Также 
достоверно различались и частоты аллелей: 
неблагоприятный Т
аллель был выявлен среди 
пациентов с частотой, в полтора раза превы
шавшей таковую в группе этнических белору
сов (52,4% против 34,9%, 
< 0,001). Такие раз
личия подтверждают описанное в литературе 
влияние полиморфного локуса rs12979860 на 
вероятность спонтанной элиминации вируса. 
Выявленное распределение генотипов
среди 
белорусов в исследованных этногеографиче
ских регионах представлено в табл.
 Распределение генотипов
 (rs12979860) у пациентов с хроническим гепатитом
С и этнических 
белорусов, %
Таблица 1
Распределение генотипов
по локусу rs12979860 среди этнических белорусов
Регион
Количество
человек
Генотипы
Т, %
Север
Центр
Восток
Запад
Юго-запад
11 (13,9)
Юго-восток
Всего
Примечание. Здесь и далее в таблицах в скобках указана частота в процентах
Этнические белорусы
Молекулярная и прикладная генетика. Том 20, 2016
г.
О.Д. Левданский и др. 
Полиморфизм генов 
-α среди коренного населения Беларуси... 
Таблица 2 
Частоты генотипов
и аллелей гена 
 у белорусов, украинцев и поляков
Выборка
Количество
Генотипы
Ссылка
Т, %
Белорусы
Поляки
59 (11,0)
Украинцы
[11]
Как видно из таблицы, существенных раз
личий между отдельными популяциями бе
лорусов не наблюдалось. Различия между 
всеми группами не достигали уровня досто
верных, а сами частоты генотипов
не про
тиворечили закону распределения Харди-
Вайнберга. Из всех регионов несколько 
выделялся восточный (
 0,12), коренное 
население которого отличалось максималь
ной частотой генотипа
CC (58,0%), а также 
минимальными долями носителей геноти
пов
CT и TT. В этом же регионе была вы
явлена минимальная частота аллеля
T. С 
наиболее низкой частотой генотип
CC был 
обнаружен среди белорусов юго-западного 
региона, где его носители составили 38,0% 
выборки. Генотип
TT оказался наиболее рас
пространенным среди коренного населения 
юго-восточного региона, где 16,0% популя
ции являются носителями данной комбина
ции аллелей. Максимальные частоты алле
ля
Т были получены для коренных жителей 
западного (38,1%) и юго-западного регио
нов (38,0%). Исходя из полученных данных, 
можно сделать предположение о том, что ко
ренные жители восточного этногеографиче
ского региона Беларуси относительно менее 
предрасположены к развитию заболеваний, 
ассоциированных с аллелем
T гена 
IL28B
(rs12979860), а белорусы, населяющие за
падный и юго-западный регионы, наоборот, 
имеют более высокий риск их развития.
Полученные нами частоты для коренных 
белорусов были сравнены с соответствующи
ми показателями, описанными для соседних 
украинской и польской выборок [11, 12]. Как 
видно из табл.
2, белорусы занимают промежу
точную позицию по частотам генотипов
CC и 
CT и лидируют по частоте генотипа
TT (13,1% 
против 11,0% и 9,0% у поляков и украинцев, 
соответственно). Максимальная частота ал
леля T была обнаружена также в белорусской 
популяции. Данные различия, однако, не до
стигают уровня достоверных: 
 0,39
– при 
сравнении белорусов с поляками и 
 0,32
при сравнении белорусской и украинской вы
борок. Таким образом, популяционные часто
ты генотипов
по локусу rs12979860 гена 
IL28B
полученные для белорусов, незначительно 
отличаются от показателей, выявленных в со
седних государствах.
По локусу rs1800629 гена 
TNF
-α было про
генотипировано 304
образца ДНК этнических 
белорусов. Носителями генотипа
GG ока
зались 234
индивида (77,0%), гетерозигот
ный генотип
GA был выявлен у 62
человек 
(20,4%), у 8
белорусов был обнаружен гено
тип
AA (2,6%). Распределение генотипов
не 
противоречило закону Харди-Вайнберга (
0,12). Частота аллеля
A составила 12,8%.
Среди 106 пациентов с хроническим ге
патитом
С различные генотипы гена 
TNF
-α 
были выявлены со следующими частотами: 
GG
– 71,7%, GA
– 27,4%, AA
– 0,9%; рас
пределение генотипов
соответствует закону 
Харди-Вайнберга (
 0,32). Сравнение рас
пределения частот генотипов
по гену 
TNF
-α 
среди этнических белорусов и пациентов с 
хроническим гепатитом
С представлено на 
Как видно из рисунка, удалось выявить не
большое превышение частоты генотипа
GG 
среди этнических белорусов, то же оказа
лось характерно и для генотипа
AA. Гетеро
зиготный генотип
GA с большей частотой 
встречался среди лиц с диагностированным 
хроническим гепатитом
С. Данные различия 
не достигают уровня достоверно значимых 
 0,26).
Распределение частот генотипов
по ис
следованным этногеографическим регионам 
представлено в табл.
3. В результате стати
Молекулярная и прикладная генетика. Том 20, 2016
г.
О.Д. Левданский и др. 
Полиморфизм генов 
-α среди коренного населения Беларуси... 
Рис.
2.
 Распределение генотипов
TNF
-α (rs1800629) между пациентами с хроническим гепатитом
С и этническими 
белорусами, %
стической обработки было выявлено досто
верное отличие юго-западного региона от 
северного (
 0,002), а также от централь
ного (
 0,002). В северном и центральном 
регионах наблюдались одни из самых низ
ких частот аллеля
А (11,1% и 9,0% соответ
ственно), в то время как в юго-западном она 
оказалась самой высокой (18,0%). Также в 
юго-западном регионе была выявлена мак
симальная частота генотипа
GA (36,0%), что 
в полтора раза превышало долю данного ге
нотипа
в идущем по этому показателю вто
рым западном регионе (24,0%). Кроме того, 
в центральном и северном регионе были вы
явлены достоверные различия в распределе
нии генотипов
по сравнению с ожидаемым 
в соответствии с законом Харди-Вайнберга 
 0,037 и 
 0,011). Причиной данных 
отличий в частотах может являться недо
статочный объем выборок для каждого из 
регионов. 
Полученные нами частоты генотипов
бы
ли сравнены с соответствующими показа
телями, описанными для соседних популя
ций поляков и русских (табл.
4) [13, 14]. 
Доли носителей различных генотипов
русской и белорусской популяции отлича
лись незначительно (
 0,49), в то время 
как разница между белорусами и поляка
ми достигла уровня достоверности (
0,012). Следует отметить, что наиболее 
близкое к польскому распределение было 
выявлено среди белорусов юго-западного 
региона, непосредственно прилегающего к 
Польше. Вполне вероятно, что отличия ко
ренного населения юго-западного региона 
Беларуси определяются вкладом польской 
популяции.
Таблица 3
Распределение генотипов
по локусу rs1800629 среди этнических белорусов
Регион
Количество 
человек
Генотипы
Север
6 (11,1)
11,1
Центр
Восток
Запад
Юго-запад
Юго-восток
11 (22,0)
11,0
Всего
Этнические белорусы
Молекулярная и прикладная генетика. Том 20, 2016
г.
О.Д. Левданский и др. 
Полиморфизм генов 
-α среди коренного населения Беларуси... 
Таблица 4 
Сравнение частот генотипов
и аллелей гена 
TNF
-α между польской, русской и белорусской 
популяциями 
Выборка
Количество
Генотипы
Ссылка
Белорусы
Поляки
Заключение
Таким образом, в рамках данного иссле
дования были впервые определены частоты 
встречаемости аллелей полиморфных локу
сов rs12979860 (ген 
IL28B
) и rs1800629 (ген 
TNF
-α) у коренного населения из шести эт
ногеографичесих регионов Беларуси. Полу
ченные распределения частот для гена 
незначительно различались между регионами, 
в то время как для гена 
-α было выявлено 
достоверное отличие юго-западного региона 
от центрального и северного. Также было об
наружено, что среди больных хроническим 
гепатитом
С частоты генотипов, содержащих 
аллель
гена
 IL28B
, равно как и частота са
мого аллеля, значительно превышают сред
непопуляционный показатель, что еще раз 
подтверждает важную роль, которую данный 
локус играет в определении вероятности спон
танной элиминации вируса.
Список использованных источников
Shepard, C.W. Global epidemiology of 
hepatitis C virus infection / C.W. Shepard, L. Fi
nelli, M.J. Alter // Lancet Infect. Dis.
– 2005.
Vol.
– P.
Genome-wide association of IL28B with 
response to pegylated interferon-alpha and riba
virin therapy for chronic hepatitis C / Y.
Tanaka 
[et al.] // Nature Genetics.
– 2009.
– Vol.
– P.
1105–1109.
Genetic variation in IL28B predicts hepa
titis C treatment-induced viral clearance / D.
[et al.] // Nature.
– 2009.
– Vol.
– P.
Genetic variation in IL28B and spontane
ous clearance of hepatitis C virus / D.L. Thomas 
[et al.] // Nature.
– 2009.
– Vol.
– №
P.
Genetics of IL28B and HCV-response to 
infection and treatment / C.N. Hayes [et al.] // 
Nature Reviews. Gastroenterology &
ogy.
– Vol.
– P.
A variant upstream of IFNL3 (IL28B) cre
ating a new interferon gene IFNL4 is associated 
with impaired clearance of hepatitis C virus / 
Prokunina-Olsson [et al.] // Nature genetics.
– Vol.
– P.
Two IL28B polymorphisms are associated 
with the treatment response of different geno
types of hepatitis C in different racial popula
tions: A meta-analysis / L.S. Wu, H. Wang, X.P. 
Geng // Experimental and Therapeutic Medi
– Vol.
– P.
Association of genetic variation in IL28B 
with hepatitis C treatment-induced viral clear
ance in the Chinese Han population / X.W. Liao 
[et al.] // Antiviral Therapy.
– 2011.
– Vol.
– P.
9.
Cytokines genes polymorphisms in 
chronic hepatitis C: Impact on susceptibility to 
infection and response to therapy / H.F. Pasha 
[et al.] // Cytokine.
– 2013.
– Vol.
61.
– №
2.
P.
478–484.
Polymorphism of tumor necrosis factor-α 
and interleukin-10 gene promoter region in 
chronic hepatitis C virus patients and their ef
fect on pegylated interferon-α therapy response 
/ G.
Dogra [et
al.] // Hum Immunol.
– 2011.
Vol.
– P.
11.
Kucherenko, A.M. Study on the 
gene ss469415590 variant in Ukrainian popu
lation / А.M. Kucherenko, V.M. Pampukha, 
Livshits // Biopolymers and Cell.
– 2014.
Vol.
– P.
12.
IL28B polymorphism (rs12979860) as
sociated with clearance of HCV infection in 
Poland: Systematic review of its prevalence 
Молекулярная и прикладная генетика. Том 20, 2016
г.
О.Д. Левданский и др. 
Полиморфизм генов 
-α среди коренного населения Беларуси... 
in chronic hepatitis C patients and general 
population frequency / M.P.
Kaczor [et
al.] // 
Pharmacological Reports.
– 2015.
– Vol.
67.
P.
260–266.
–308 G/A
-α gene polymorphism in
�uences the course of basal cell carcinoma in 
Polish population / M.
Sobjanek [et
al.] // Arch 
Med Sci.
– 2015.
– Vol.
11.
– №
– P.
14.
TNF gene polymorphisms in cystic �brosis 
patients: contribution to the disease progression 
/ G.
Shmarina [et al.] // Journal of Translational 
Medicine.
– 2013. doi: 10.1186/1479-5876-11-19.
, V.
.V. 
 AN
AT
 PAT
AT
Institute of Genetics and Cytology of the National Academy of Sciences of Belarus
Minsk BY-220072, Republic of Belarus
Minsk BY-220116, Republic of Belarus
Minsk BY-220030, Republic of Belarus
IL28B
 and 
TNF
-α genotypes in Belarusians from six ethnographic regions and patients with chronic hepatitis C were 
analyzed. The frequencies obtained for 
 gene were not signi�cantly different between regions, but it was found 
that south-western region is different from central and northern regions in 
-α genotypes distribution. CT and TT 
genotypes and T allele of 
 gene were found in patients with signi�cantly higher frequencies in comparison with 
Дата поступления статьи 26 февраля 2016 г.
Молекулярная и прикладная генетика. Том 20, 2016
г.
УДК 575.1: 618.39–021.3
Н.Г. Седляр, А.Л. Гончар, М.Д. Амельянович, И.Б. Моссэ
РОЛЬ ГЕНЕТИЧЕСКИХ ФАКТОРОВ В ПРЕДРАСПОЛО
ЕННОСТИ 
ИВАНИЮ БЕРЕМЕННОСТИ
Институт генетики и цитологии НАН Беларуси
Республика Беларусь, 220072, г. Минск, ул. Академическая, 27
Исследована ассоциация 8 полиморфных вариантов генов, ответственных за нарушения системы гемостаза, 
с невынашиванием беременности. Сравнение генотипов женщин с патологией беременности (1631 человек) 
и контрольной группы случайной выборки жителей г. Минска (663 человека) позволило выявить наиболее 
информативные маркеры риска нарушения беременности
– это полиморфные варианты 4G/4G гена 
PAI-1
Leu/Leu гена 
, а также аллель Ala гена 
. Анализ частоты сочетаний факторов риска в группе пациенток 
показал, что чаще всего встречаются комбинации следующих факторов риска: 
PAI
 (41,9%), 
PAI
 (30,4%) и 
 (20,4%). Нередко встречается также комбинация из трех факторов риска: 
PAI
+ А1298С), 
+ А1298С), 
PAI
. Выявление носительства 
данных мутаций и полиморфных вариантов является актуальным и важным, поскольку коррекция эффектов 
выявленных неблагоприятных вариантов генов с помощью соответствующей терапии обеспечивает нормаль
ное протекание беременности.
Ключевые слова:
 невынашивание беременности, генетическое тестирование, ПЦР.
Введение
Одним из приоритетных направлений фун
даментальных и прикладных научных иссле
дований в Беларуси определены новые репро
дуктивные технологии, здоровье беременной 
женщины и плода, матери и ребенка. И это 
неслучайно: проблема бесплодия и невына
шивания беременности становится все более 
актуальной. В условиях неблагоприятной де
мографической ситуации, когда каждые пять 
лет на 20% уменьшается число женщин, спо
собных родить ребенка, особенно важно со
хранение и развитие беременности у супру
жеских пар, желающих иметь детей.
По данным Министерства здравоохранения 
Беларуси, в нашей стране 10–25% беременно
стей оканчивается неудачно, причем этот по
казатель с 1998
года вырос на 8%. Согласно 
определению Всемирной организации здраво
охранения, спонтанным абортом (самопроиз
вольным выкидышем) называется прерывание 
беременности сроком до 22
недель или рож
дение плода с массой менее 500
г. Привычное 
невынашивание беременности (потеря трех 
и более последовательных беременностей)
относительно редко встречающаяся патоло
гия (у 1% супружеских пар) [1]. В настоящее 
время считается, что генетическое тестирова
ние должно проводиться не позже, чем после 
выкидышей, т.к. риск повторного невына
шивания в этом случае составляет 24%, после 
– 30%, а после 4-х
В противоположность этому, однократный 
выкидыш встречается довольно часто (у 25% 
женщин). Более 80% всех прерываний бере
менности (спорадических, повторных) про
исходит в первом триместре.
Причины выкидыша, как эпизодического 
(однократного или повторного), так и привыч
ного (потеря трех и более последовательных 
беременностей) сходны. Их можно объединить 
в следующие группы: генетические, инфекци
онные, эндокринные, анатомические, иммуно
логические, идиопатические [3].
В последнее время одной из главных причин 
выкидышей стали считать наследственную 
тромбофилию
– патологическое состояние орга
низма, характеризующееся повышенной склон
ностью к тромбообразованию. Изменения ге
нов, ответственных за систему гемостаза, одной 
из основных функций которой является под
держание нормальных реологических свойств 
крови, могут приводить к тромбофилии и быть 
причиной невынашивания беременности.
Молекулярная и прикладная генетика. Том 20, 2016
г.
Н.Г. Седляр и др.
 Роль генетических факторов в предрасположенности к невынашиванию беременности
С точки зрения нарушения плодо-плацен-
тарного кровотока как одного из патогенети
ческих механизмов, приводящих к развитию 
патологии беременности, большой интерес 
представляет изучение генетических полиморф
ных вариантов, при которых происходят те или 
иные изменения в процессах свертывания крови.
Исследования последних лет показали, что 
наличие генетической предрасположенно
сти к тромбофилии сопряжено с повышен
ным риском развития осложнений во время 
беременности (привычное невынашивание, 
плацентарная недостаточность, задержка ро
ста плода, поздний токсикоз и др.). Один из 
механизмов, приводящих к этим осложнени
ям,
– неправильное прохождение процессов 
имплантации и плацентации, важную роль в 
которых играют системы свертывания крови и 
фибринолиза (процесса растворения тромбов 
и сгустков крови).
Генетические нарушения системы гемостаза 
часто проявляются только при дополнительных 
условиях, одним из которых как раз и является 
беременность. Беременность сама по себе яв
ляется состоянием, в 5–6
раз увеличивающим 
риск тромбозов, поскольку даже при физиоло
гическом ее течении происходит повышение 
тромбогенного потенциала и снижение тром
борезистентности. Однако эти процессы не 
сопровождаются появлением в крови прямых 
маркеров внутрисосудистого свертывания кро
ви, прижизненной внутрисосудистой агрегаци
ей тромбоцитов и повышением содержания в 
крови маркеров дисфункции эндотелия, поэто
му клинико-биохимические анализы не выявля
ют отклонений от нормы. При наследственной 
тромбофилии происходит нарушение одного 
или нескольких звеньев в системе фибринолиза, 
что в конечном итоге приводит к неадекватно
му обеспечению растущего плода кислородом 
и питательными веществами вследствие обра
зования микротромбов в плаценте, в результате 
чего беременность прекращает развиваться, что 
приводит к самопроизвольному выкидышу или 
«замершей» беременности.
Среди причин наследственных тромбофилий 
широко обсуждается связь между мутацией 
фактора V
Leiden, мутацией G20210-A в гене 
протромбина, полиморфизмами С677-Т в гене 
метилентетрагидрофолатредуктазы (
MTHFR
), 
4G/5G
– в гене ингибитора активатора плазми
ногена
I (
PAI
-I), G/A 455
– в гене фибриногена и 
развитием тяжелого гестоза, задержки внутриу
тробного развития плода, преждевременной от
слойки нормально расположенной плаценты и 
другими осложнениями беременности [4–12].
Выявление носительства данных мутаций 
и полиморфных вариантов имеет важную и 
неоспоримую значимость, поскольку профи
лактика и своевременная коррекция эффектов 
неблагоприятных вариантов генов обеспечи
вает нормальное протекание беременности. 
Большое значение в формировании генетиче
ской предрасположенности к невынашиванию 
имеет не только носительство аллелей риска 
по отдельности, но и их комбинации.
В этой связи целью данной работы явля
лось изучение и сопоставление частот встре
чаемости вариантов генов-кандидатов риска 
у пациенток с патологией беременности по 
сравнению с контрольной группой и оценка 
взаимосвязи носительства комбинаций вы
явленных факторов риска с формированием 
генетической предрасположенности к нару
шениям беременности, а также выявление ал
лельных вариантов, обладающих наибольшей 
прогностической ценностью.
Материалы и методы
В исследовании были проанализированы 
образцы ДНК 1631
пациента с привычным 
невынашиванием беременности. Контрольная 
группа состояла из случайной выборки насе
ления г.
Минска (663
человека).
Для определения генетической предраспо
ложенности к невынашиванию беременности 
были отобраны 8
полиморфных вариантов ге
нов, ассоциированных с тромбообразованием 
или повышенной гомоцистеинимией.
В гене метилентетрагидрофолатредуктазы 
были проанализированы два полиморфиз
ма
– С677Т и А1298С. Необходимость анализа 
обоих полиморфных вариантов этого гена об
условлена тем, что гетерозиготность по одно
му из полиморфных вариантов не приводит к 
повышению уровня гомоцистеина, однако в 
компаунде они являются фактором риска даже 
в гетерозиготном состоянии.
Гены-кандидаты, отобранные для анализа, и 
описание их функций в отношении беремен
ности (по литературным данным) приведены 
в табл.
Молекулярная и прикладная генетика. Том 20, 2016
г.
Н.Г. Седляр и др.
 Роль генетических факторов в предрасположенности к невынашиванию беременности
Таблица 1
Генетические факторы предрасположенности к патологиям беременности
Аббревиатура, название гена и 
полиморфный вариант
Функции гена
(ген I фактора свертывания 
I фактор свертывания крови регулирует последний этап коагуляци
онного каскада, влияет на образование «белого» тромба. Связан с 
риском возникновения сердечно-сосудистых заболеваний.
(ген II фактора свертывания 
Мутация гена протромбина является фактором риска многих ослож
нений (невынашивание беременности, фетоплацентарная недоста
точность, внутриутробная гибель плода, гестозы, задержка развития 
плода, отслойка плаценты). Риск потери плода в 1 триместре.
(ген V фактора свертывания 
(мутация Лейдена)
У женщин с мутацией 
 обнаруживают тромбозы в плаценте, что 
повышает риск развития осложнений беременности: невынашивания 
беременности на ранних сроках (риск повышается в 3 раза), отстава
ния развития плода, позднего токсикоза, фетоплацентарной недоста
точности.
(ген XIII фактора свертывания 
Val34Leu
У носителей аллеля 34Leu количество фибриназы соответствует 
показателям нормы, но активность этого фермента повышена в 2–3 
раза. Аллель 34Leu наблюдается у женщин с привычным невына
шиванием беременности. Риск привычного невынашивания беремен
ности еще выше у лиц-носителей аллеля в сочетании с вариантом 
4G/4G в гене 
PAI-1
PAI-1
(ген ингибитора активатора 
плазминогена)
Регулирует процесс фибринолиза. Повышение уровня 
PAI-1
гипоксии приводит к снижению фибринолиза. Аллель 4G или гено
тип 4G/4G связаны с привычным невынашиванием беременности, 
увеличением риска тяжелого гестоза, гипоксии, задержки развития и 
внутриутробной гибели плода.
(ген эндотелиальной синтазы 
окиси азота)
Выявлена ассоциация данного полиморфизма с привычным невына
шиванием беременности, частота аллеля 4а была значимо выше при 
привычном невынашивании, чем в контрольной группе. Генотипы 
4b/4a рассматриваются как нежелательные варианты.
(ген метилентетрагидрофола
тредуктазы)
Фермент играет ключевую роль в метаболизме фолиевой кислоты, 
необходимой для роста и развития кровеносной и иммунной систем. 
У лиц, гомозиготных по данному полиморфизму (генотип Т/Т), про
исходит снижение активности фермента примерно до 35% от средне
го значения и развитие гипергомоцистеинемии. Генотип TT является 
фактором риска при сердечно-сосудистых заболеваниях, осложнени
ях протекания беременности. Данные эффекты можно корректиро
вать дополнительным приемом препаратов фолиевой кислоты.
(ген метилентетрагидрофола
тредуктазы)
При замене аденина (А) на цитозин (С) снижается активность гена. 
Такое носительство приводит к гипергомоцистеинемии только при 
совместном носительстве с алеллем 677T того же гена. При отсут
ствии аллеля 677T гомозиготность по полиморфизму 1298C не со
провождается ни повышением концентрации общего гомоцистеина, 
ни снижением уровня фолата в плазме, но является фактором риска 
спонтанного аборта (снижение активности фермента до 60% в связи 
с изменением регуляции ингибитором S-аденозилметионином).
В качестве биологического материала для 
исследования использовали ДНК, выделенную 
из клеток буккального эпителия или лейко
цитов периферической крови. Концентрацию 
образцов ДНК измеряли с помощью флюори
метра Qubit (Invintrogen, USA).
Генотипирование по полиморфизмам 4G/5G 
гена 
PAI
, G20210А гена 
F2
, G1691A гена 
F5
С677T и А1298C гена 
MTHFR 
осуществляли 
методом количественной ПЦР с использованием 
Молекулярная и прикладная генетика. Том 20, 2016
г.
Н.Г. Седляр и др.
 Роль генетических факторов в предрасположенности к невынашиванию беременности
праймеров и флюоресцентно-меченых зондов и 
набора реагентов для проведения ПЦР в реаль
ном времени (Maxima Probe qPCR Master Mix, 
Thermo Scienti�c, Литва).
Детекция флюоресценции, а также первич
ная обработка результатов осуществлялись 
программным обеспечением прибора CFX96 
(BIO-RAD, США) в автоматическом режи
ме. Исследования генов 
 и 
, а также по
лиморфных вариантов С677T и A1298C гена 
MTHFR 
осуществлялись методом мульти
плексной ПЦР в реальном времени (попарно 
в одной пробирке), что значительно ускоряет 
и удешевляет проведение анализа.
Для выявления вставок/делеций гена 
(4a/4b) использовали двухпраймерную систе
му, для определения полиморфизма в гене 
(Thr312Ala) применяли методику на осно
ве RFLP PCR (Restriction Fragment Length 
Polymorphism), для генотипирования образ
цов по гену 
F13
 (Val34Leu) применяли соб
ственную методику на основе Tetra-primer 
ARMS PCR (Ampli�cation Refractory Mutation 
System), с использованием отдельных стан
дартных компонентов реакционной смеси и 
аллель-специфичных праймеров. Разделение 
продуктов амплификации и рестрикции про
водили с помощью электрофореза в 8%-ном 
полиакриламидном геле и визуализировали в 
проходящем УФ-свете после окраски в раство
ре бромистого этидия.
Статистическую обработку полученных дан
ных проводили с помощью непараметрического 
критерия
 с учетом поправки Йетса с исполь
зованием пакета Microsoft Of�ce Excel. Оценку 
влияния полиморфных вариантов на риск раз
вития заболевания проводили с помощью отно
шения шансов (OR) с учетом 95% доверитель
ного интервала (95% CI). Результаты анализа 
считали статистически значимыми при уровне 
< 0,05. Характер распределения наблюдае
мых частот генотипов в популяции оценивали 
на соответствие уравнению Харди-Вайнберга.
Результаты и обсуждение
Проведена оценка информативности генов-
кандидатов риска невынашивания беремен
ности среди белорусских женщин. Результа
ты генотипирования основной и контрольной 
групп по анализируемым генам предрасполо
женности к невынашиванию беременности 
представлены в табл.
Таблица 2
Сравнение частот генотипов и аллелей изученных полиморфных вариантов генов 
в группе пациенток и в контрольной группе
Ген,
полиморфизм
Генотипы, 
аллели
Частота,%
Контроль
PAI-1
Молекулярная и прикладная генетика. Том 20, 2016
г.
Н.Г. Седляр и др.
 Роль генетических факторов в предрасположенности к невынашиванию беременности
Ген,
полиморфизм
Генотипы, 
аллели
Частота,%
Контроль
Val34Leu
Val/Val
Val/Leu
Val
1,11 (0,85–1,46)
Продолжение табл. 2
Примечание. n
– количество пациенток; n
– контрольная группа
Наиболее выраженные различия между ча
стотами генотипов и аллелей в исследуемых 
выборках наблюдались для полиморфных ва
риантов 4G/5G гена 
PAI-1
, Thr312Ala гена 
и Val34Leu гена 
Ген 
PAI-1
 регулирует процесс фибрино
лиза. По нашим данным, наличие генотипа 
4G/4G гена 
PAI-1
 увеличивает риск пато
логии беременности в 1,32 раза (OR
 1,32 
95% CI 1,03–1,69), а наличие аллеля риска 
4G увеличивает риск в 1,26 раза (OR
 1,26 
95% CI 1,08–1,47). Вместе с тем, не получено 
подтверждения негативного вклада генотипа 
4G/5G гена 
PAI-1
 в невынашивание беремен
ности, в то время как, согласно литературным 
данным, этот генотип также считается фак
тором риска [13].
По литературным данным, аллель 34Leu ге
на
F13
 наблюдается у 51% женщин с привыч
ным невынашиванием беременности. Риск 
привычного невынашивания беременности 
еще выше у носителей аллеля в сочетании с 
вариантом 4G/4G в гене 
PAI-1
 [14]. При анали
зе распределения частот генотипов полимор
физма Val/Leu гена 
F13
 в группе пациенток и 
контрольной группе нами выявлены значимые 
различия (χ
 6,59, 
 0,04). Согласно получен
ным нами результатам, наличие генотипа Leu/
Leu увеличивает риск невынашивания беремен
ности в 1,87 раза (OR   1,87 95% CI 1,08–3,23).
Молекулярная и прикладная генетика. Том 20, 2016
г.
Н.Г. Седляр и др.
 Роль генетических факторов в предрасположенности к невынашиванию беременности
По нашим данным, наличие аллеля Ala по
лиморфного варианта Thr312Ala
гена 
 уве
личивает риск невынашивания беременности 
В то же время нами не обнаружено стати
стически значимых отличий в распределении 
частот генотипов и аллелей среди пациенток с 
невынашиванием беременности и в контроль
ной группе по мутациям G20210A гена 
 и 
G1691A гена 
, несмотря на то, что эти му
тации известны как факторы, существенно по
вышающие риск тромбообразования [10]. Со
гласно нашим данным, частота встречаемости 
мутации Лейдена в контрольной группе соста
вила 2,60%, а мутации гена 
F2
 (G20210A)
1,20%, что ниже среднеевропейских частот, 
описанных в литературе [10].
Также нами не выявлено статистически зна
чимых различий в распределении частот ге
нотипов и аллелей полиморфных вариантов 
С667Т и А1298С гена 
в исследован
ных группах. Согласно литературным данным, 
факторами риска являются гомозигота Т/Т по 
полиморфизму С667Т, гомозигота С/С по по
лиморфизму А1298С, а также комплекс гете
розигот С/Т и А/С [15].
Таким образом, по результатам полученных 
нами данных, наибольший вклад в генетиче
скую предрасположенность к невынашиванию 
беременности среди белорусских женщин вно
сят следующие аллельные варианты генов: 
4G/4G гена 
PAI-1
, Leu/Leu гена 
, а также 
аллель Ala гена 
Поскольку в формировании генетической 
предрасположенности к невынашиванию 
беременности имеет значение не только но
сительство аллельных вариантов риска по 
отдельности, но и их комбинации, нами про-
анализирована частота ряда сочетаний факто
ров риска в группе пациенток.
Анализ группы пациентов проводился по 
трем параметрам:
комбинации гетерозиготных аллельных 
вариантов риска;
комбинации гомозиготных аллельных ва
риантов риска;
комбинации гомозиготных и гетерозигот
ных аллельных вариантов риска.
Результаты анализа представлены на рисунке. 
Для полиморфных вариантов, у которых гетеро
зиготные варианты не являются факторами рис-
ка, анализ по первому из параметров не прово
дился
– частота встречаемости приравнивалась 
к нулю. Объемы выборок для каждого сравне
ния варьировались от 1310 до 1627
пациентов.
По полученным результатам можно сделать 
вывод, что чаще всего встречаются комбина
ции ассоциированных с невынашиванием ва
риантов следующих генов: 
FXIII

PAI
 (41,9%), 
eNOS 
ab

PAI
 (30,4%), 
eNOS 
ab

F13
 (20,4%). 
Нередко встречается также комбинация из 
трех факторов риска: 
PAI
А1298С) (31,2%), 
F13

MTHFR 
(С677Т
А1298С) (20,9%), 
eNOS 
ab

F13

PAI
 (16,6%).
Обращает на себя внимание то, что несмо
тря на различия между частотами неблагопри
ятных вариантов полиморфизмов 4b/4a гена 
, С677Т и А1298С гена 
у паци
енток и в контрольной группе нами не были 
выявлены – эти варианты часто встречаются 
в сочетании с другими факторами риска. Воз
можно, они усиливают эффекты других генов 
и поэтому также вносят существенный вклад 
в предрасположенность к невынашиванию 
беременности.
Комбинации в сочетании с мутацией Leiden 
 G1691A) или мутацией гена протромбина 
 G20210A) встречаются редко, что связано 
с низкой частотой встречаемости этих мута
ций, как в группе пациенток, так и в контроль
ной группе.
Заключение
Проведено исследование ассоциации 8
по
лиморфных вариантов генов, ответственных 
за нарушения системы гемостаза, с невына
шиванием беременности. Сравнение гено
типов 1631
пациентки с патологией бере
менности и контрольной группы случайной 
выборки жителей г.
Минска (663
человека) 
позволило выявить наиболее информатив
ные маркеры риска нарушения беременно
сти
– это полиморфные варианты 4G/4G ге
на 
PAI-1
, Leu/Leu гена 
F13
, а также аллель 
Ala гена 
F1
Поскольку в формировании генетической 
предрасположенности к невынашиванию бе
ременности имеет значение носительство не 
только отдельных аллельных вариантов ри
ска, но и их комбинации, проанализирована 
частота сочетаний факторов риска в группе 
пациенток. Показано, что чаще всего встре
Молекулярная и прикладная генетика. Том 20, 2016
г.
Н.Г. Седляр и др.
 Роль генетических факторов в предрасположенности к невынашиванию беременности
Рисунок. 
Распределение частот встречаемости комбинаций генотипов, связанных с невынашиванием беременности
чались комбинации связанных с невынаши
ванием вариантов генов 
F13

PAI

eNOS 
ab
PAI

eNOS 
ab

F13
. Кроме того, довольно 
часто встречалась комбинация из трех фак
торов риска: 
PAI

MTHFR

F13

MTHFR
eNOS 
ab

F13

PAI
Выявление носительства данных мутаций 
полиморфных вариантов является актуаль
ным и важным, поскольку коррекция эффектов 
выявленных неблагоприятных вариантов генов 
с помощью соответствующей терапии обеспе
чивает нормальное протекание беременности.
eNOS ab + F13 + PAI
PAI + MTHFR 677/MTHFR 1298
PAI + F2
PAI + F13
PAI + F5
PAI + F1
eNOS ab + PAI
Частота встречаемости комбинации, %
Гетерозиготы
Гомозиготы
Гомозиготы + гетерозиготы
Молекулярная и прикладная генетика. Том 20, 2016
г.
Н.Г. Седляр и др.
 Роль генетических факторов в предрасположенности к невынашиванию беременности
Список использованных источников
www.ncbi.nlm.nih.gov/gene/4846.
– Date of ac
Leclerc, D. Molecular biology of methy
lenetetrahydrofolate reductase (
) and 
overview of mutations/polymorphisms [Elec
tronic resource] / The National Center for Bio
technology Information.
– Mode of access: http://
www.ncbi.nlm.nih.gov/books/NBK6561/.
Бескоровайная Т.С. Влияние некоторых 
генетических факторов на нарушение 
репродукции у человека: дис. канд. мед. наук: 
03.00.15 / Т.С.
Бескоровайная.
– Москва, 
11.
Ethnic distribution of factor V Leiden in 
4047 men and women. Implications for venous 
thromboembolism screening / P.M. Ridker // 
– Vol.
–P.
Rodeghiero, F. Activated protein C resis
tance and factor V Leiden mutation are indepen
dent risk factors for venous thromboembolism / 
F. Rodeghiero, A.
Tosetto // Ann Intern Med.
– Vol.
–P.
The 4G/4G polymorphism of the hypo�
brinolytic plasminogen activator inhibitor type 1 
gene: an independent risk factor for serious preg
nancy complications / C.J.
Glueck [et
al.] // Me
– 2000.
– Vol.
– №
– P.
Plasminogen activator inhibitor 1 4G/5G 
polymorphism and coagulation factor XIII Val
34Leu polymorphism: im
PAI
red �brinolysis and 
early pregnancy loss / A.
al.] // Clinical chemistry.
– 2003.
– Vol.
– P.
Isotalo, P.A. Neonatal and fetal methy
lenetetrahydrofolate reductase genetic polymor
phisms: an examination of C677T and A1298C 
mutations / P.A.
Isotalo, G.A.
Wells, J.G.
nelly // The American Journal of Human Genet
– Vol.
– P.
Study on potential role of apolipoprotein 
E in recurrent pregnancy loss / E.
Korkmazer [et 
al.] // Experimental and therapeutic medicine.
– Vol.
Тихомиров, А.Л. Привычное невынаши-
вание беременности: причины, диагностика 
и современные подходы к терапии / А.Л.
Ти-
хомиров, Д.М.
Лубнин // Фарматека.
– 2004.
Т. 1.
Серов, В.Н. Привычное невынашивание 
беременности: современные представления 
о патогенезе, диагностике и лечении / 
Серов, В.М.
Сидельникова, Е.В.
жаров 
// журнал РОАГ.
Alpha�brinogen Thr312Ala polymorphism 
and venous thromboembolism / A.M.
Carter // 
– Vol.
– P.
1177–1179. 
Ассоциация наследственных факторов 
тромбофилии с невынашиванием бере-
менности у женщин в русской популяции: 
отчет о НИР / ГУ Медико-генетический 
научный центр РАМН; Е.А.Калашникова, 
С.Н Кокаровцева.
– Москва, 2005.
– 3
115478.
P05121 (
PAI
1_HUMAN) [Electronic re-
source] / The Universal Protein Resource (Uni
– 2014.
– Mode of access: http://www.
uniprot.org/uniprot/P05121.
– Date of access: 
Endothelial nitric oxide synthase gene 
(NOS3) variant and hypertension in pregnan
cy [Electronic resource] / The National Cen
ter for Biotechnology Information.
– 2001.
Mode of access: http://www.ncbi.nlm.nih.gov/
pubmed/?term 11745998.
– Date of access: 
NOS3 nitric oxide synthase 3 [Electronic 
resource] / The National Center for Biotechnolo
gy Information.
– 2014.
– Mode of access: http://
Молекулярная и прикладная генетика. Том 20, 2016
г.
Н.Г. Седляр и др.
 Роль генетических факторов в предрасположенности к невынашиванию беременности
edlyar, 
. Gonchar, M.D. 
C FACT
Institute of Genetics and Cytology of the National Academy of Sciences of Belarus
Minsk BY-220072, Republic of Belarus
Association of 8 genetic polymorphisms responsible for hemostasis disorders with pregnancy loss was investigated. 
Genotypes of women who had recurrent miscarriages were compared with those of control group. It allowed identifying 
the most informative polymorphisms – 4G\4G of gene 
PAI-1
, Leu/Leu of gene 
 and allele Ala of gene 
. Some 
combinations of two risk polymorphisms were found to be prevalent: 
 + 
PAI
 (41,9%), 
 ab + 
PAI
 (30,4%) and 
 ab + 
 (20,4%). The combinations of three risk polymorphisms:
PAI
 + 
 (С677Т + А1298С), 
 (С677Т + А1298С), 
 ab + 
 + 
PAI
 are also common. Molecular-genetic investigation of women with 
recurrent miscarriages is very urgent because therapeutic correction of effects of detected negative genes provides 
Дата поступления статьи 1 ферваля 2016 г.
Молекулярная и прикладная генетика. Том 20, 2016
г.
Л.В. Кухтинская, А.В. Зураев, В.А. Будевич, И.Б. Моссэ
СОВРЕМЕННЫЕ ПРЕДСТАВЛЕНИЯ О ГЕНЕТИЧЕСКИХ 
ДЕТЕРМИНАНТАХ ПСИХО
МОЦИОНАЛЬНОЙ УСТОЙЧИВОСТИ 
ЧЕЛОВЕКА
Обзорная статья
Институт генетики и цитологии НАН Беларуси; e-mail: [email protected]
Республика Беларусь, 220072, г. Минск, ул. Академическая, 27
Данная обзорная статья освещает современное состояние исследований в области генетики стрессоустой
чивости. Рассмотрены основные механизмы и пути развития эмоционального стресса, связанные с функцио
нированием систем транспортеров и рецепторов ряда О-катехоламинов и нейропептидов, таких как серото
нин, дофамин, норадреналин, окситоцин и вазопрессин. Взаимодействие множества генов, ассоциированных 
с психологическими особенностями человека, а также влияние факторов среды на разных этапах онтогенеза 
обуславливают индивидуальные различия стрессоустойчивости индивидуума.
Ключевые слова:
 стрессоустойчивость, генетические механизмы, система серотонина, система норадре
налина, система окситоцина.
УДК 575.1: 618.39-021.3
Введение
Многие особенности современного мира 
способствуют повышению уровня психоэмо-
ционального напряжения, возникновению та
ких психических состояний, как тревога, неудо
влетворенность жизнью, раздражительность, 
агрессивность, депрессия и
др. [1]. В 1990-х
гг. 
началось изучение молекулярно-генетических 
основ отдельных свойств характера личности и 
темперамента, и на сегодняшний день неоспо
римо значение генетических факторов в форми
ровании индивидуальной вариативности отдель
ных психологических характеристик личности.
В формирование индивидуальных вариаций 
психодинамики в целом и психоэмоциональной 
устойчивости в частности вовлечено множе
ство генов, как правило, с небольшим вкладом 
каждого из них, что делает задачу выявления 
роли конкретного гена чрезвычайно сложной. 
К примеру, вклад наследственности в форми
рование черт темперамента составляет 30–60% 
[2]. Посредством ряда семейных, близнецовых 
и эпидемиологических исследований установ
лено, что наследуемость, например, тревожно
сти составляет около 45% (чрезмерной тревож
ности
– 70–90% для монозиготных близнецов), 
депрессии в качестве психоэмоционального 
расстройства
– 38%, а в качестве клиническо
го заболевания
– 48–76% [3–5]. При этом тре
вога и депрессия генетически гетерогенны [5]. 
Депрессивно-маниакальный психоз (биполяр
ное расстройство) на 68%, а шизофрения на 
34% генетически детерминированы [5]. Также 
в близнецовых исследованиях показана высо
кая наследуемость социальных фенотипов [6].
Выявление генетических маркеров стрессо-
устойчивости является весьма значимым и 
представляет огромный интерес как для пони
мания молекулярно-генетических механизмов 
психологической устойчивости в отдельном 
этносе, так и для создания программ, выяв
ляющих успешность в профессиональной 
деятельности, для формирования групп риска 
по развитию пограничных состояний и психи
ческих заболеваний, для разработки программ 
профилактики и коррекции девиантного пове
дения и создания эффективных лекарственных 
препаратов.
Концепции, связывающие 
психологические свойства личности 
биологическими характеристиками
В современном понимании наследственные 
особенности черт личности обусловлены гене
тической детерминированностью нейронных 
систем мозга. Такому подходу предшествовал 
Молекулярная и прикладная генетика. Том 20, 2016
г.
Л.В. Кухтинская и др. 
Современные представления о генетических детерминантах психоэмоциональной...
ряд теорий эмоций, сосуществующих парал
лельно либо сменяющих друг друга («Клас
сическая», «Таламическая», «Биологическая», 
«Вегетативно-гуморальная» и
др.) [7]. Соглас
но анатомо-физиологической теории эмоций 
Дж.
Грэя, все виды эмоций порождаются тре
мя нейронными системами, которые, в свою 
очередь, определяют появление трех основных 
групп эмоций. А индивидуальные особенности 
эмоциональности человека зависят от баланса 
этих эмоциональных систем. Повышенная ак
тивация одной из систем Дж.
Грэя (система
В/5) 
предопределяет склонность человека к высокой 
тревожности [7]. Позже С.Р.
Клонингер выдви
нул гипотезу о взаимосвязи функционирования 
нейромедиаторных систем мозга с особенно
стями темперамента (психобиологическая мо
дель индивидуальности) [8]. Затем Д.Е.
Коминг 
(2000) уточнил, что формирование личностных 
черт происходит при взаимодействии генов 
различных нейромедиаторных систем мозга, 
т.е.
нейродинамикой мозга в целом [9]. При 
изучении психодинамики часто используется 
дименсионный подход Г.
Айзенка, выделивше
го три основных измерения личности (темпера
мента): экстраверсия, нейротизм, психотизм, и 
Р.
Кэттела, чья модель темперамента включает 
уже 16
личностных факторов, которые, по мне
нию В.Б.
Павленко, сводятся к трем, отчетливо 
представляющим экстраверсию, нейротизм и, 
частично, психотизм [10]. В настоящее время 
все большее распространение получают идеи 
Д.Е.
Коминга.
При эмоциональном стрессе неблагоприятные 
факторы воздействуют на организм опосредо
ванно, через включение отношения челове
ка к ситуации, т.е. первостепенным является 
восприятие ситуации как угрожающей. По 
мнению В.Э.
Мильмана, психический стресс 
можно представить в качестве функции двух 
факторов: величины потребности в достиже
нии и субъективной оценки вероятности до
стижения [12].
Физиологические механизмы развития 
стресс-реакции на психологический стресс 
типичны. После воздействия стресс-фактора 
информация от рецепторов поступает в неокор
текс, ретикулярную формацию, лимбическую 
систему и гипоталамус, где подвергается эмо
циональной оценке с формированием вывода 
о значимости информации для организма в са
мом неокортексе [13, 14]. Если ситуация вос
принимается как угрожающая, то по сигналу 
от гипоталамуса посредством медиатора нор-
адреналина и норадренергических элементов 
лимбико-ретикулярной системы происходит 
быстрая активация симпатоадреналовой си
стемы (САС) и более медленная
– гипоталамо-
гипофизарно-адреналовой системы (ГГАС), 
приводящая к высвобождению гормонов стрес
са (катехоламины, кортикостероиды и
др.) [14, 
15], что запускает каскад специфических реак
ций, характерных для стресса. Многие физиоло
гические и биохимические реакции на психоло
гический и физиологический стресс являются 
общими (активация стресс-реализующей (САС 
и ГГАС) и стресс-лимитирующей (эндогенная 
опиоидная и ГАМК) систем, подавление ре
продукции, изменение поведения, снижение 
аппетита и умеренная гипертермия и
др.) [14]. 
Однако при некоторой типичности физиоло
гических проявлений стресса после запуска 
защитных механизмов, на этапе оценки уров
ня угрозы наблюдается большое разнообразие 
психологических реакций [16].
В ряде исследований показано, что длитель
ный, чрезмерный или повторяющийся стресс 
оказывает влияние на развитие и проявление 
психических расстройств, включая беспокой
ство, депрессию, посттравматическое стрессо
вое расстройство и шизофрению, при наличии 
наследственной предрасположенности [17], а 
также посредством эпигенетической регуля
ции активности генов [18].
Психоэмоциональная устойчивость 
механизм развития эмоционального 
стресса
Важными этапами становления понятия 
психоэмоциональной устойчивости является 
разработка Г.
Селье (1936) учения о стрессе 
Р.
Лазарусом (1966) когнитивной теории 
стресса и копинга (в рамках которой рассма
тривается системный (физиологический) и 
психический (эмоциональный) стресс, а так
же копинговые (когнитивные, эмоциональ
ные и поведенческие) стратегии осознанного 
поведения для совладания со стрессом) [11]. 
В настоящее время под психоэмоциональной 
устойчивостью понимается стрессоустойчи
вость к эмоционально окрашенным факторам. 
Молекулярная и прикладная генетика. Том 20, 2016 г.
Л.В. Кухтинская и др. 
Современные представления о генетических детерминантах психоэмоциональной...
Проблематика исследования 
молекулярно-генетических основ 
психоэмоциональной устойчивости
В настоящее время подавляющее боль
шинство работ по поиску ассоциаций гене
тических полиморфизмов с личностными 
характеристиками проводится на людях, 
страдающих различными психическими рас
стройствами в целях поиска генетических 
основ заболеваний. Таких исследований явно 
недостаточно для формирования полноцен
ного представления о наследуемости такой 
психологической характеристики, как психо
эмоциональная устойчивость. Назрела необ
ходимость идентификации устойчивых пси
хотипов и их генетических маркеров.
5.
В человеческой популяции существует 
большая когорта индивидов, сохраняющих от
носительную психологическую стабильность в 
условиях чрезмерной эмоциональной нагрузки. 
К психологические чертам, способствующим 
формированию психоэмоциональной устойчиво
сти личности, можно отнести тип темперамента 
(сангвинический по Гиппократу, экстравертный 
по Г.
Айзенку, аффективно-экзальтированный по 
К.
Леонгарду), адекватный уровень самооценки, 
тревожности и личной ответственности (в боль
шей мере присущей интерналам), мотивацию на 
достижение цели [11, 26, 27].
6.
Большинство отделов мозга формируют
ся полностью к 20–25
годам, и в течение жизни 
наблюдаются изменения экспрессии ряда ге
нов [28, 29]. В
работах ряда авторов выявлены 
возрастные отличия функционирования дофа
минергической, серотонинергической и нора
дренергической систем. Существует некоторая 
вариабельность личностных черт с возрастом, 
обусловленная процессами социокультурного 
развития (снижается уровень нейротизма, за
висимости от вознаграждения, мотивации [21, 
30, 31] и все более значимым становится опыт 
социального взаимодействия [32]).
При оценке стрессоустойчивости не
обходимо учитывать уровень навыка психо
логической саморегуляции (эмоционального 
интеллекта) и тот факт, что в полной мере 
оценка стрессоустойчивости возможна толь
ко в экстремальных условиях [1].
Противоречивость данных при поиске гене
тических детерминант стрессоустойчивости 
обусловлена рядом проблем, возникающих на 
пути исследователя. Это и межгенные взаи
модействия, и сложности определения вклада 
социокультурной среды на всех этапах онтоге
неза, и сложности методического плана.
Уровень психоэмоциональной устойчи
вости, как и другие черты темперамента, за
висит от суммарного взаимодействия многих 
генов. Вклад отдельного гена составляет по
рядка 1–4% [19]. На сегодняшний день, обна
ружены хромосомные регионы, сцепленные 
с определенными психотипами либо психи
ческими заболеваниями [20], что частично 
объясняет некоторые спорные результаты, 
полученные разными группами исследова
телей, поскольку ассоциация гена с опреде
ленной психологической чертой может быть 
обусловлена его локализацией.
Проявление генов модифицируется в за
висимости от условий среды (при различном 
уровне стресса). Огромное значение имеет 
предшествующий опыт индивида. Влияние 
социокультурной среды особенно важно на 
ранних этапах формирования личности (до 
лет), что сказывается на особенностях 
проявления индивидуальных черт, детерми
нируемых каким-либо полиморфным вари
антом гена [20]. Индивидуальные особенно
сти психодинамики зависят от ряда факторов 
окружающей среды, таких как стиль воспита
ния, насилие и наличие стрессовых ситуаций 
в детстве, воспитание в неполной семье, се
зон рождения, порядок рождения, социально-
экономический статус [21, 22, 23, 24].
Поскольку на проявление генов пси
хоэмоциональной устойчивости (и психоди
намики в целом) воздействуют социально-
средовые факторы, в целях успешности и 
валидности исследования требуется про
ведение большого объема дополнительных 
психологических и клинико-лабораторных 
тестов. К примеру, изменение уровня глюко
зы в крови в ответ на умеренный стресс-тест 
может служить хорошим диагностическим 
Гены серотонинергической системы
Серотонин является одним из модуляторов 
реакций гипоталамо-гипофизарно- надпочеч
никовой оси на острый и хронический стресс. 
Молекулярная и прикладная генетика. Том 20, 2016
г.
Л.В. Кухтинская и др. 
Современные представления о генетических детерминантах психоэмоциональной...
С нарушением функции серотонинергической 
системы связывают развитие психических на
рушений, проявляющихся депрессией и трево
гой. Снижение уровня серотонина усиливает 
агрессивное поведение и импульсивность, 
тогда как повышение серотонинергической 
активности такие проявления нивелирует [33].
Ген транспортера серотонина (
5-НТТ,
SL
6A4
). 
Транспортер серотонина отвечает за 
активный транспорт серотонина в нейронах 
головного мозга, а также во многих перифе
рических тканях [34]. Кодирующий его ген 
имеет размер 37,8
Кб, локализован в хромосо
ме 17q11.2 и состоит из 14
экзонов [35]. Функ
циональный инсерционно-делеционный
 п
оли
морфизм 5-
 (
включает 
14
(аллель
S) или 16
(аллель
L) повторяющихся 
последовательностей в районе промотора гена 
[19, 31]. Показано, что при наличии короткого 
аллеля
S экспрессия гена снижается на 60–70% 
в головном мозге и на 30–40%
– в лимфобластах 
по сравнению с носителями только аллеля

[34, 36]. Влияние полиморфизма
5-HTTLPR 
проявляется в модулировании реакции чело
века на стресс. Носители аллеля
L отличаются 
агрессивностью и импульсивностью, асоциаль
ным поведением [35, 37, 38], а аллель
S связан 
с большей вероятностью развития психоэмо
циональных нарушений (депрессии, посттрав
матического стрессового расстройства) в не
благоприятной среде (стресс, усталость) и 
алкогольной зависимости [39, 40, 41].
Рецепторы транспортера серотонина. 
Все 
рецепторы серотонина, за исключением 5-НТ3, 
сопряжены с G-белком. 5-НТ3 относится к 
рецепторам ионного канала [42, 43]. 
Ген ре
цептора серотонина 
1A
 расположен в 
регионе 5q12.3 хромосомы и не имеет интро
нов. Полиморфизм
C-1019G (rs
6295), пред
ставляющий собой замену в промоторной об
ласти гена, существенно влияет на степень его 
экспрессии. Генотип
СС ассоциирован с более 
высоким риском возникновения депрессии [44], 
развитием мигрени [45, 46]. В свою очередь, 
носители аллеля
G отличаются повышенным 
нейротизмом и имеют высокие показатели по 
шкале избегания ущерба [44]. Имеются данные 
о связи аллеля
G с паническим расстройством 
[47]. Полиморфные варианты 
гена рецептора 
серотонина 
5-НТ2А
 связаны с развитием пси
хических, поведенческих расстройств, ней
родегенеративных заболеваний, нарушением 
ритма сна. Ген 
5-НТ2А
 локализован в 13ql4–q21 
области хромосомы, имеет 2 интрона и 3 экзо
на. На сегодняшний день достаточно активно 
исследуется 
полиморфизм
Т102С (rs
6313). 
Аллель
Т ассоциирован с усилением экспрес
сии гена [48–50]. Носители генотипа
ТТ отли
чаются повышенным уровнем агрессивности 
[51] и стрессогенным ухудшением глубины и 
длительности сна. У гетерозигот
СТ отмечен 
высокий уровень профессионального стрес
са [52]. Наличие в генотипе одного аллеля
ассоциировано с алкогольной зависимостью, 
склонностью к депрессиям и тревожностью [53, 
54]. В
работе В.Е.
Голимбета, проводившего ис
следование двух полиморфных маркеров Т102С 
и А-1438G у здоровых индивидов русской по
пуляции, показано, что генотипы 5-НТ2А ТС и 
5-НТ2А АG, в отличие от гомозиготных гено
типов, отличаются пониженным уровнем соци
альной интроверсии и тревожности, что может 
свидетельствовать о большей социабельности и 
активности гетерозигот [55]. 
Гены рецепторов 
5-H
3A
 и 
5-НТ3В
 локализованы в регионах 
11q23.1 и 11q23.2 соответственно. В последнее 
время публикуется большое число работ, опи
сывающих влияние данного типа рецепторов 
на процессы, лежащие в основе систем памяти 
[56]. Также имеются данные о связи 
полиморф
ного варианта С178Т (rs
l062613) 
со склон
ностью к тревожности у лиц, не страдающих 
заболеваниями психиатрического профиля [57] 
и с лабильностью настроения при биполярном 
расстройстве [58].
Гены дофаминергической системы
Функциональное разнообразие эффектов 
дофаминергической системы определяется 
наследственными различиями в структуре и 
уровне экспрессии белков DAT, СОМТ, DRD1, 
DRD2, DRD3, ТН1, DBH, МАОВ и
др. Синтез 
медиатора дофамина в мозге постепенно воз
растает от рождения до трехлетнего возраста, 
имея при этом характерное онтогенетическое 
распределение в различных зонах мозга [59]. 
Полиморфизмы генов дофаминергической 
системы связаны с уровнем тревожности 
и обуславливают проявление таких черт 
личности, как экстраверсия, импульсив
ность, стремление к новизне [8, 21, 60]. Дан
Молекулярная и прикладная генетика. Том 20, 2016 г.
Л.В. Кухтинская и др. 
Современные представления о генетических детерминантах психоэмоциональной...
ная система, совместно с миндалевидным 
комплексом, является ведущей в развитии 
тревожно-депрессивных расстройств [61, 62]. 
Повышенная тревожность ассоциирована с 
увеличением площади базолатеральной груп
пировки миндалевидного комплекса, что мо
жет служить диагностическим критерием [61].
Ген транспортера дофамина (
DA

SL
6A3

кодирует синтез белка-переносчика до
фамина (DAT1 или SLC6A3), который играет 
важную роль в нейротрансмиссии, ограничи
вая активность дофаминергической системы 
в синапсах. DAT1 принадлежит к семейству 
Na
/Cl
-зависимых переносчиков нейроме
диаторов, интегрирован в мембрану клетки и 
осуществляет обратный захват нейромедиато
ра в пресинаптические терминалы. Ген 
DAT1
человека, длиной 52,6
т.п.н., локализован на 
5-ой хромосоме в регионе р15.33 и содержит 
15
экзонов [63,64]. Одним из наиболее изучен
ных является полиморфизм числа тандемных 
повторов (VNTR) гена 
DAT1
 в 3'-нетрансли
руемой области гена (3'-UTR) с числом копий 
от 3 до 13 (длина одной копии 40
п.н.) [65]. По
скольку полиморфный сайт лежит вне откры
той рамки считывания DAT, полиморфизм
VN
TR может влиять на уровень экспрессии DAT 
[66] в зависимости от числа копий повторов. 
Носители генотипа с 9
единицами повтора об
ладают повышенной тревожностью по срав
нению с носителями других генотипов [67]. 
Имеются данные о связи полиморфизма
VNTR 
с уровнем эмоциональности, эмпатии у взрос
лых индивидуумов [24]. В свою очередь носи
тели генотипа
9R9R склонны к агрессивному 
и асоциальному поведению [68]. Обнаружена 
также ассоциация полиморфизма
VNTR с син
дромом дефицита внимания (СДВГ), болезнью 
Паркинсона, шизофренией, алкоголизмом, ку
рением, употреблением наркотиков [69, 70].
Ген 
рецептора 
дофамина 2 (
D2

являет
ся наиболее значимым среди генов-рецепторов 
дофамина. Дофаминовые рецепторы типа
экспрессируются преимущественно в стриа
туме (полосатом теле), коре головного моз
га, среднем мозге, и особенно широко рас
пространены в лимбической системе [21, 
62]. У
человека ген, кодирующий рецептор 
дофамина 2DRD2, расположен на участке 
11q22.3–23.1 и содержит ряд полиморфных 
маркеров. Известен полиморфизм
TaqlA (Glu
713Lys, С939Т, rs
1800497), локализованный в 
экзоне
8, который оказывает функциональное 
влияние на уровень экспрессии рецептора. 
Полиморфизм
TaqlA ассоциирован с долго
временной памятью у психически здоровых 
людей, расстройствами эмоциональной сфе
ры при маниакально-депрессивном психозе, 
шизофрении [62, 71, 72]. Минорный аллель
(Т, 
или А1) характеризуется более низким уров
нем экспрессии в сравнении с аллелем (С, или 
А2) [21, 71] и ведет к снижению плотности 
рецепторов в стриатуме. Носители аллеля
(Т), частота встречаемости которого в евро
пейской популяции составляет 18%, обладают 
повышенной тревожностью [67].
Ген фермента катехол-О-метилтранс-
феразы (
кодирует фермент, участву
ющий в обмене нейропептидов (окситоцина, 
вазопрессина и
др.), в том числе и катаболиз
ме дофамина в межклеточном пространстве, 
в связи с недостатком в префронтальной ко
ре переносчика дофамина [71, 72]. Динами
ка данных нейропептидов в разных участках 
мозга регулирует социальное поведение [72]. 
Ген 
СОМТ
 расположен на участке 22ql1.1–
ql1.2. Существуют 2
изоформы данного фер
мента: S-СОМТ (растворимая изоформа, об
наружена в крови и периферических тканях) 
и МВ-СОМТ (мембран-связанный протеин, 
основная часть которого локализована в пре
фронтальной коре) [73, 74]. Наиболее известен 
полиморфизм
G472
 (rs
4680), представляю
щий собой однонуклеотидную замену в экзо
не 4
гена с замещением аминокислоты Val на 
Met в кодоне
158 для изоформы МВ-СОМТ и 
в 108
кодоне
– для S-COMT [73]. Аллель
связан с низкой дофаминергической актив
ностью и термостабильностью, что сопрово
ждается повышением уровня дофамина в пре
фронтальной коре, а аллель
Val
– с высокой 
дофаминергической активностью (в 3–4
превышает таковую у носителей аллеля
[71, 73]. Носители аллеля
Val отличаются 
более выраженным чувством сострадания и 
имеют преимущество в решении задач с эмо
циональным компонентом [75]. Полиморфизм 
гена связан с когнитивными функциями [71, 
73, 75], восприятием боли, психическими рас
стройствами, склонностью к самоубийству, 
агрессивностью [76], экстраверсией [77] и по
иском новизны [74, 78].
Молекулярная и прикладная генетика. Том 20, 2016
г.
Л.В. Кухтинская и др. 
Современные представления о генетических детерминантах психоэмоциональной...
Гены норадренергической системы
Ген 
ОХТ
– ген прогормона, кодирующий 
синтез предшественника окситоцина и ней
I (НФ1), локализован в хромосоме 
20р13, охватывает 3647
п.о. и содержит 4
экзо
на. Окситоцин
– нейропептид с гормональной 
функцией, синтезируется в супраоптическом 
и паравентрикулярном ядрах гипоталамуса и 
транспортируется в секреторных гранулах со
вместно с НФ1 к задней доле гипофиза [91]. 
Окситоцин снижает секрецию адренокорти
котропного гормона (АКТГ) и кортизола, со
ответственно, тем самым угнетая ответ ГГАС 
[92]. Имеются данные о влиянии социально-
средовых факторов на экспрессию гена и ее 
изменение посредством эпигенетической ре
гуляции [93].
Окситоцин играет ключевую роль в регу
ляции сложных социальных когниций и в со
циальном поведении, в том числе в форми
ровании привязанности [94], нравственных 
качеств, тревоги и страха [95]. Нейропептид 
окситоцин сопряжен со сниженным гормо
нальным ответом на стресс и сниженной тре
вожностью у пациентов с депрессией [74, 96]. 
При поступлении сигнала из окружающей со
циальной среды и его интерпретации в каче
стве «безопасного», окситоцин способствует 
формированию просоциального поведения, в 
случае поступления «небезопасных» сигналов 
формируется антисоциальное поведение [97]. 
Поскольку экспрессия окситоцина у женщин 
выше, чем у мужчин, окситоцин обуславливает 
половые различия в реакции на стресс. 
Ген рецептора окситоцина (O
XTR

ло
кализован в хромосоме 3р25–3р26.2, охва
тывает 17
Кб и имеет 4
экзона и 3
интрона 
[95, 98]. Синтезируемый полипептид содер
жит 389
аминокислот и принадлежит к IG-
рецепторам [95]. В последние годы проведено 
много исследований, которые показали связь 
гена 
OXTR
 с аутизмом [98], шизофренией, пси
хопатиями [99].
На сегодняшний день 
полиморфный ва
риант rs
53576 (G/А), 
локализованный в 
третьем интроне OXTR, рассматривают как 
особенно перспективный в исследовании 
социально-ориентированного поведения [94]. 
В сравнении с носителями гомозиготного ва
рианта по аллелю G rs
53576 (GG), индивиды 
с одним или двумя копиями аллеля
A (AG/
АА) проявляют более низкую поведенческую 
Согласно современным представлениям, 
гены адренергических рецепторов связаны с 
мотивацией [31], тревожностью, склонностью 
к депрессии и суициду [79], а также с форми
рованием раздражительности и враждебности 
[9]. Гиперфункция норадренергической систе
мы вызывает возбуждение и усиление поис
ковой активности [59, 80].
Среди генов норадренергеческой системы 
можно выделить 4
наиболее значимых гена, 
ответственных: за синтез норадреналина (ген 
дофамин-3-гидроксилазы 
DBH
), за его транспорт 
(ген переносчика норадреналина
NET1
), за рецеп
цию (ген альфа-2А-адренорецептора 
ADRA2A
) и 
за метаболизм (ген моноаминоксидазы 
МАОА
).
Ген транспортера норадреналина 
NET
NET1

SLC6A2
) локализован на хромосоме 
16ql2.2 и состоит из 14
экзонов [81], протяжен
ностью 45
Кб [79]. Транспортер норадренали
на осуществляет обратный захват в пресинап
тические терминалы 80–90% норадреналина, 
секретированного из синапсов в межсинапти
ческое пространство, оставшиеся 10–20% по
падают в кровь и экстранейрональные ткани. 
Транспортер норадреналина принимает уча
стие и в транспорте дофамина [82]. Ген 
связан с депрессией (79, 83, 84), увеличением 
риска асоциального поведения у взрослых и 
токсикоманией, а также СДВГ [59, 80].
Ген альфа-2А-адренорецептора (
AD
A2A
кодирует бета
2 адренергический рецептор, 
локализован в хромосоме 10q25.2, охватывает 
п.н. и состоит из 1
экзона [85]. Наиболее 
изучен 
полиморфизм
–1291
>G (rs
1800544). 
Носители аллеля
G отличаются предрасполо
женностью к СДВГ [59, 85], шизофрении и 
алкоголизму [86], невнимательностью [87], за
медленным восприятием [88]. В
то
же время, 
ряд авторов указывают на отсутствие связи 
гена 
 с уровнем норадреналина плаз
мы и эмоциональной устойчивостью [89, 90].
Система окситоцина
Система окситоцина (гены 
ОХТ
TR
играет ключевую роль в выраженности пси
хологической и физиологической реакции на 
стресс при наличии либо отсутствии психоло
гической поддержки [74].
Молекулярная и прикладная генетика. Том 20, 2016 г.
Л.В. Кухтинская и др. 
Современные представления о генетических детерминантах психоэмоциональной...
диспозиционную эмпатию [91], отличаются 
пониженным уровнем оптимизма и чувства 
собственного достоинства [100]. Носители 
генотипа GG характеризуются повышенным 
доверием к окружающим [101]. У лиц с одной 
или двумя копиями G аллеля
(rs
53576) при 
наличии социальной поддержки уровень кор
тизола в ответ на стресс ниже, в сравнении с 
людьми с таким же генотипом, но не получав
ших никакой социальной поддержки [73]. Но
сители аллеля
G являются более чуткими, чув
ствуют себя менее одинокими в социальном 
окружении, применяют более эмоциональные 
методы воспитания, имеют более низкие пока
затели развития аутизма и склонны к сопере
живанию [102].
Таким образом, исследования последних лет 
показывают, что генетические полиморфизмы 
генов системы окситоцина, оказывая влияние 
на эффективность позитивного социального 
взаимодействия, выступают в роли защитного 
фактора в стрессовой ситуации.
степени регулирует социальное поведение 
мужчин. Функциональные исследования ука
зывают на высокую концентрацию аргинин-
вазопрессина в плазме крови у пациентов с 
депрессией, суицидальным поведением [110] 
и при аутизме [111].
Ген аргинин-вазопресинового рецепто
ра
1А (
1A
 локализован в хромосоме 
12q14.2 и имеет 3 экзона, продукт гена состо
ит из 418 аминокислот [112]. Промоторный 
регион гена 
AVPR1A
 (12q14–15) характеризу
ется наличием трех функциональных микро
сателлитных повторов ((GT)25, RS1 и RS3). 
Локус RS3
в промоторном регионе гена связан 
с формированием доминантного типа соци
ального поведения у шимпанзе [113], склон
ностью к моногамному поведению у полевок 
и качеством отношений в паре у человека 
[96, 114]. Полиморфизм
ассоциирован со 
склонностью к поиску новизны и «избеганию 
ущерба» [115].
Ген аргинин-вазопрессинового рецепто
ра 1B (
 протяженностью 8008
п.о. 
локализован в хромосоме lq32.1 и состоит 
из 2
экзонов [116]. Рецептор 1В аргинин-
вазопрессина опосредует стимуляторные эф
фекты аргинин-вазопрессина на синтез адре
нокортикотропного гормона (АКТГ) [117]. 
Ассоциативные исследования также выявили 
вовлеченность гена 
AVPR1B
 в развитие агрес
сивного поведения [118], аффективных и па
нических расстройств [117, 119].
Система аргинин-вазопрессина
Ген предшественника аргинин-вазо-
прессина (

локализован в хромосоме 
20р13 и содержит 4
экзона. Кодирует про
белок, который является предшественником 
нескольких белковых продуктов: нейропеп
тидного гормона аргинин-вазопрессина, 
нейрофизина
2 и копептина [104, 105, 106, 
107]. Копептин и вазопрессин выделяются 
в кровоток в эквимолярных концентрациях, 
но, в отличие от вазопрессина, копептин име
ет больший размер и большее время жизни 
(20
минут). В связи с этим его рекомендуют 
использовать для определения количества 
выделившегося вазопрессина [108]. Необхо
димо отметить, что психологический стресс 
приводит к увеличению уровня копептина 
[105].
Аргинин-вазопрессин
– нейропептид, при
нимающий участие в активации ГГАС, в 
процессах обучения и в регуляции социаль
ного поведения (привязанности, агрессии, 
тревожности и
т.д.) [96]. Синтез аргинин-
вазопрессина связан с циркадными ритмами 
[106]. Усиление генной экспрессии наблюда
ется при выраженном стрессе и самозащите 
[109]. В отличие от гена 
AVP
 в большей 
Изучение половых особенностей 
стрессоустойчивости
Половые различия психодинамики объяс
няются дифференцированным влиянием ан
дрогенов, прогестинов и эстрогена на реали
зацию эффектов нейромедиаторных систем 
у мужчин и женщин [120]. Имеются данные 
о половой специфичности ассоциаций мно
гих генов с различными психическими при
знаками и заболеваниями [30, 121]. В ряде 
работ отмечается повышение тревожности 
(нейротизма) у женщин в сравнении с муж
чинами [21]. Важную роль в формировании 
гендерных особенностей социального пове
дения играют системы окситоцина и аргинин-
вазопрессина, а также сами половые гормоны 
и их рецепторы.
Молекулярная и прикладная генетика. Том 20, 2016
г.
Л.В. Кухтинская и др. 
Современные представления о генетических детерминантах психоэмоциональной...
Заключение
Genetics of human social behavior / 
R.P.
Ebstein [et
al.] // Neuron.
– 2010.
– Vol.
– P.
Глотова, Г.А. Интерсубъективность бес-
сознательного / Г.А.
Глотова, Н.С.
Минаева.
Екатеринбург: Изд-во Урал. ун-та, 2005.
Cloninger, C.R. A psychobiological model 
of temperament and character / C.R.
Cloninger, 
Svrakic, T.R.
Przybeck. // Arch. Gen. Psy
chiatry.
– Vol.
– P.
Comings, D.E. Reward de�ciency syn
drome: genetic aspects of behavioral disorders 
/ D.E.
Comings, K.
Blum // Prog. Brain Res.
– Vol.
– P.
Павленко, В.Б. Роль аминергических 
нейронных систем мозга в формировании 
индивидуальных особенностей поведения 
/ В.Б.
Павленко // Таврический медико-
биологич. вестн.
– 2003.
– Т.
6, №
– С.
11.
Водопьянова, Н.Е. Психодиагностика 
стресса / Н.Е.
Водопьянова.
– СПб.: Издат. 
дом «Питер», 2013.
Мильман, В.Э. Стресс и личностные 
факторы регуляции деятельности / 
Мильман // Стресс и тревога в спорте: 
сб.
ст. / сост.: Ю.Л.
– М., 1983.
Charmandari, E. Endocrinology of the 
stress response / E.
Charmandari, C.
Tsigos, 
Chrousos // Annu. Rev. Physiol.
– 2005.
Vol.
– P.
Chrousos, G.P. Stress and disorders of the 
stress system / G.P.
Chrousos // Nat. Rev. Endo
– Vol.
– P.
G.P. Glucocorticoid action net
works and complex psychiatric and/or somatic 
disorders / G.P.
Throusos, T.
Kino // Stress.
– Vol.
– P.
Психофизиологические и нейрохими-
ческие механизмы стресса и шока: экспе-
римент и модель / С.Б.
Парин [и
др.] // Вестн.
Нижегородского ун-та им.
Лобачев-
ского.
17.
Luethi, M. Stress effects on working 
memory, explicit memory, and implicit memo
ry for neutral and emotional stimuli in healthy 
men / M. Luethi, B. Meier, C. Sandi // Front. 
Behav. Neurosci.
– 2009.
– Vol.
2, №
P.
1–9.
Многочисленные данные о наследуемости 
психологических черт личности создают пред
посылки к дальнейшему поиску молекулярно-
генетических маркеров предрасположенности 
к психоэмоциональной устойчивости. Созда
ние психобиологической модели С.Р.
Клонин
гера и концепции Д.Е.
Коминга, послужило 
началом широкомасштабных исследований 
генетических основ психодинамики. Все фор
мы поведения человека детерминированы 
большим числом генов, которые влияют на 
психологические особенности индивидуума, 
но не определяют их, а обуславливают опре
деленный тип реакции организма на те или 
иные условия среды. И хотя вклад аллелей от
дельных генов в формирование психоэмоцио
нальной устойчивости невелик, суммирование 
эффектов аллелей многих генов, а также учет 
эпигенетических факторов помогут в поиске 
генов предрасположенности к психологиче
ской стрессоустойчивости. Только комплекс
ное исследование взаимосвязи генетических 
факторов, с психологическими и физиоло
гическими показателями, с учетом социаль
ных факторов, позволит выявить ключевые 
молекулярно-генетические маркеры, ассоции
рованные с проявлением психоэмоциональной 
устойчивости.
Список использованных источников
1.
Аболин, Л.М. Эмоциональная устойчи-
вость и пути ее повышения / Л.М.
Аболин // 
Вопросы психологии.
– 1989.
– №
– С.
141–149.
2.
Saudino, K.J. Behavioral genetics and child 
temperament / K.J.
Saudino // J.
Dev. Behav. Pe
diatr.
– 2005.
– Vol.
26, №
3.
– P.
214–223.
Increased amygdala activation to angry 
and contemptuous faces in generalized social 
phobia / M.B.
Stein [et
al.] // Arch. Gen. Psy
chiatry.
– 2002.
– Vol.
59, №
11.
– P.
Uher, R. Gene-environment interactions in 
severe mental illness / R.
Uher // Front. Psychia
try.
– Vol.
– P.
Joint analysis of psychiatric disorders in
creases accuracy of risk prediction for schizo
phrenia, bipolar disorder, and major depressive 
disorder / R.
Maier [et
al.] // Am. J.
Hum. Ge-
– Vol.
– P.
Молекулярная и прикладная генетика. Том 20, 2016 г.
Л.В. Кухтинская и др. 
Современные представления о генетических детерминантах психоэмоциональной...
18.
Genetic variation in FKBP5 associated with 
the extent of stress hormone dysregulation in ma
jor depression / A.
Menke [et
al.] // Genes Brain 
Behav.
– 2013.
– Vol.
12, №
3.
– P.
289–296.
Assotiation of anxiety-related traits with a 
polymorphism in the serotonin transporter gene 
regulatory region / K.P.
Lesch [et
al.] // Science.
– Vol.
– P. 1527–1531.
Identi�cation of risk loci with shared ef
fects on �ve major psychiatric disorders: a ge
nome-wide analysis / Cross-Disorder Group of 
the Psychiatric Genomics Consortium // Lan
– 2013.
– Vol.
381, №
– P.
Казанцева, А.В. Молекулярно-
генетические основы черт темперамента 
и личности : автореф. дис. ... канд. биол. 
наук : 03.00.15 / А.В. Казанцева; РАН, Ин-т 
биохимии и генетики
The socio-economic status of communities 
predicts variation in brain serotonergic respon
sivity / S.B.
Manuck [et
al.] // Psychol. Med.
– Vol.
– P.
23.
The association between conduct problems 
and maltreatment: Testing genetic and environ
mental mediation / R.J. Schulz-Heik [et
al.] // Be
hav. Genet.
– 2010.
– Vol.
40, №
3.
– P.
338–348.
Gene-Environment Correlation Between 
the Dopamine Transporter Gene (DAT1) Poly
morphism and Childhood Experiences of Abuse 
/ W.
Rehan [et
al.] // J.
Interpers. Violence.
– P.
The change in blood glucose level after a 
moderate stress as a parameter of stress reactiv
ity in anxiety and depression: a pilot translation
al study / S.V.
Freiman [et
al.] // Neurochemi
– Vol.
– P.
Русалов, В.М. О природе темперамента 
и его месте в структуре индивидуальных 
свойств человека / В.М. Русалов // Вопросы 
психологии.
27.
Ильин, Е.П. Мотивация и мотивы / Е.П. 
Ильин.
– СПб: Издат. дом «Питер», 2013.
– 512
с.
Association study between the novel func
tional polymorphism of the serotonin transporter 
gene and suicidal behaviour in schizophrenia / 
V. De Luca [et
al.] // Eur. Neuropsychopharma
– Vol.
– P.
Low self-esteem is related to aggression, 
antisocial behavior, and delinquency / M.B.
nellan [et
al.] // Psychol. Sci.
– 2005.
– Vol.
– P.
Вовлеченность полиморфных маркеров 
гена рецептора эстрогена альфа (ESR1) в 
вариации черт личности / Ю.Ю. Кутлумбетова 
др.] // Вестн. Башкирского ун-та.
– 2014.
Т.
31.
Полиморфизм генов серотонинового 
обмена и мотивационно-потребностная сфера 
личности / Л.А.
Рядовая [и
др.] // Вестн. Томского 
гос. пед. ун-та.
– 2009.
– Т.
81, №
3.
– С.
49–53.
Барский, В.И. Анализ ассоциаций поли-
морфных маркеров генов дофаминергической 
(DRD2/ANKK1) и серотонинергической 
(HTR2A) систем мозга с личностными харак-
теристиками подростков / В.И.
М.Г.
Аксенова, О.Б.
Козлова // Эколог. 
генетика.
– Т.
A polymorphism in the serotonin receptor 
3A (HTR3A) gene and its association with harm 
avoidance in women / J.
Melke [et
al.] // Arch. 
Gen. Psychiatry.
– 2003.
– Vol.
60, №
P.
Crabbe, J.C. Genetic contributions to ad
diction / J.C.
Crabbe // Annu. Rev. Psychol.
– Vol.
– P. 435–462.
Kendler, K.S. Genetic and environmen
tal pathways to suicidal behavior: re�ections of 
a genetic epidemiologist / K.S.
Kendler // Eur. 
Psychiatry.
– 2010.
– Vol.
25, №
– P. 300–303.
Allelic variation of human serotonin trans
porter gene expression / A.
Heils [et
al.] // J. Neu
– 1996.
– Vol.
66, №
– P. 2621–2624.
37.
Serotonin transporter genetic variation and the 
response of the human amygdala / A.R.
Hariri [et
al.] 
// Science.
– 2002.
– Vol.
297, №
5580.
– P. 400–403.
38.
Holmes, A. Abnormal behavioral pheno
types of serotonin transporter knockout mice: 
parallels with human anxiety and depression / 
A.
Holmes, D.L.
Murphy, J.N.
Crawley // Biol. 
Psychiatry.
– 2003.
– Vol.
54, №
10.
– P.
953–959.
Ассоциация полиморфизма 5-HT
TLPR гена SLC6A4 с показателями простой 
и сложной зрительно-моторных реакций и 
критической частоты световых мельканий 
у спортсменов под влиянием физической 
нагрузки / Е.В.
Трушкин [и
др.] // Бюл. экспер. 
биол.
– Т.
Поликанова, И.С. Связь серотонинового 
транспортера (5НТТ) с развитием 
утомления / И.С.
Поликанова, О.В.
Сысоева, 
А.Г.
Тоневицкий // Психологические исслед.
– Т. 5, №
Молекулярная и прикладная генетика. Том 20, 2016
г.
Л.В. Кухтинская и др. 
Современные представления о генетических детерминантах психоэмоциональной...
41.
Alcohol dependence and serotonin transporter 
functional polymorphisms 5-HTTLPR and rs25531 
in an Italian population / E.
Pascale [et
al.] // Alcohol 
Alcohol.
– 2015.
– Vol.
50, №
3.
– P.
259–265.
Перспективы изучения полиморфизмов 
ключевых генов нейромедиаторных систем. 
II. Серотонинергическая система 
/ М.А.
Тимофеева [и
др.] // Физиология 
человека.
– Т.
114–124.
Characterization of single-nucleotide 
polymorphisms in coding regions of human 
genes / M.
Cardill [et
al.] // Nat. Genet.
– 1999.
Vol.
– P.
44.
Попова, Н.К. Роль серотонина мозга в 
экспрессии генетически детерминированного 
защитно-оборонительного поведения / Н.К.
По-
пова, Л.И.
Корочкин, Н.Н.
Кудрявцева // 
Генетика.
– 2004
– Т.
40, №
6.
– С.
770–778.
Polymorphic variants of the serotonin re
ceptor, 5-HT1A, and the serotonin transporter, 
5-HTTLPR, and adverse pregnancy outcomes: a 
pilot study / H.
Taube [et
al.] // J. Reprod. Health 
– Vol.
– P.
Genetic association of 5-HT1A and 
5-HT1B gene polymorphisms with migraine in a 
Turkish population / O.
Ates [et
al.] // J.
– Vol.
– P.
Колесникова, Л.И. Гены нейромедиа-
торных систем и психоэмоциональные 
свойства человека: серотонинергическая 
система / Л.И.
Колесникова, В.В.
Долгих, 
Гомбоева // Бюллетень ВСНЦ СО 
РАМН.
– 2011.
Reif, A. Toward a molecular architecture 
of personality / A. Reif, K.P. Lesch // Behav. 
Brain Res.
– 2003.
– Vol.
139, №
– P.
Genomic structure and expression of the 
human serotonin 2A receptor gene (HTR2A) 
locus: identi�cation of novel HTR2A and anti
sense (HTR2A-AS1) exons / C.L.
Ruble [et
– Vol.
– P.
Association of the serotonin transporter 
and receptor gene polymorphisms in neuropsy
chiatric symptoms in Alzheimer disease / F.
sal [et
al.] // Arch. Neurol.
– 2004.
– Vol.
– P.
Meta-analysis of genetic association stud
ies supports a contribution of common variants to 
susceptibility to common disease / K.E.
ueller [et
al.] // Nat. Genet.
– 2003.
– Vol.
– P. 177–182.
Effect of 5-HT2A receptor polymorphisms 
and occupational stress on self-reported sleep 
quality: a cross-sectional study in Xinjiang, 
China / Y.
Jiang [et
al.] // Sleep Med.
– 2016.
Vol.
– P.
The International HapMap Project / In
ternational HapMap Consortium // Nature.
– Vol.
– P.
The CC genotype in the T102C HTR2A 
polymorphism predicts relapse in individuals 
after alcohol treatment / A.
Jakubczyk [et
// J.
Psychiatr. Res.
– 2013.
– Vol.
47, №
P.
Голимбет, В.Е. Полиморфные варианты 
гена рецептора серотонина (5-HTR2A) и 
особенности личности / В.Е.
Голимбет, М.В. 
Алфимова, Н.Г.
Митюшина // Молекулярная 
биология.
– Т.
The HTR3A polymorphism c. –42C>T 
is associated with amygdala responsiveness in 
patients with irritable bowel syndrome / L.A. 
Kilpatrick [et
al.] // Gastroenterology.
– 2011.
Vol.
– P.
Outcome de�nitions and clinical predic
tors in�uence pharmacogenetic associations 
between HTR3A gene polymorphisms and re
sponse to clozapine in patients with schizophre
nia / A.P.
Rajkumar [et
al.] // Psychopharmacol
ogy.
– Vol.
– P.
Niesler, B. 5-HT 3 receptors: potential of 
individual isoforms for personalised therapy / 
Niesler // Curr. Opin. Pharmacol.
– 2011.
Vol.
11, №
– P.
59.
Григоренко, Е.Л. Генетические осно-
вы синдрома дефицита внимания с гипер-
активностью / Е.Л.
Григоренко // Вестн. Сев. 
(Арктического) федерального ун-та. Сер.: 
Естественные науки.
– 2010.
– №
1.
– С.
43–54.
Benjamin, J. Molecular genetics and hu
man personality / J.
Benjamin, R.P.
Belmaker.
– Washington; London: Ameri
Калимуллина, Л.Б. Анализ ассоциаций 
по сочетаниям генотипов полиморфных 
ДНК-локусов (TAG 1A и NCOI) DRD2, 
256A/G гена SLC6A3 и объемных характе-
ристик миндалевидного комплекса моз-
га с повышенной тревожностью / Л.Б.
Ка-
лимуллина, А.В.
Ахмадеев, А.Я.
Ханнанова 
// Успехи современного естествознания.
2011.
11.
9–11.
Молекулярная и прикладная генетика. Том 20, 2016 г.
Л.В. Кухтинская и др. 
Современные представления о генетических детерминантах психоэмоциональной...
62.
Леушкина, Н.Ф. Исследование влия-ния 
фактора пола на поведение крыс с различиями 
аллельной структуры гена рецептора дофамина 
второго типа (DRD2) в тесте приподнятый 
крестообразный лабиринт и морфометрические 
характе-ристики миндалевидного комплекса 
мозга / Н.Ф.
Леушкина, А.В.
Ахмадеев, Л.Б.
Ка-
лимуллина // Успехи современного естес-
твознания.
– 2010.
– №
10.
– С. 9–13.
63.
Response to methylphenidate is not in�u
enced by DAT1 polymorphisms in a sample of 
Brazilian adult patients with ADHD / V.
Contini 
[et
al.] // J.
Neural. Transm.
– 2010.
– Vol.
117, 
2.
– P.
269–276.
64.
Interactions between early parenting and a 
polymorphism of the child’s dopamine transport
er gene in predicting future child conduct disorder 
symptoms / B.B.
Lahey [et
al.] // J. Abnorm. Psy
chol.
– 2011.
– Vol.
120, №
1. P.
33–45.
Association of maternal dopamine trans
porter genotype with negative parenting: evi
dence for gene x environment interaction with 
child disruptive behavior / S.S.
Lee [et
al.] // Mol. 
Psychiatry.
– 2010. Vol.
– P.
The VNTR polymorphism of the human 
dopamine transporter (DAT1) gene affects gene 
expression / S.
Fuke [et
al.] // Pharmacogenom
– Vol.
– P.
Куликова, М.А. Полиморфизмы генов 
дофаминергической системы
– маркеры 
проявления тревожности и у спортсменов : 
автореф. дис. ... канд. биол. наук : 14.00.51 / 
Куликова ; Федеральное гос. учреждение 
«Всерос. научн.-исслед. ин-т физич. культуры 
и спорта»
Allelic association of a dopamine trans
porter gene polymorphism with antisocial be
havior in heroin-dependent patients / G.
al.] // Addict. Biol.
– 2005.
– Vol.
10, №
P.
Beaver, K.M. The interaction between 
genetic risk and childhood sexual abuse in the 
prediction of adolescent violent behavior / K.M. 
Beaver // Sex. Abuse.
– 2008.
– Vol.
20, №
P.
Рудых, Н.А. Применение аутосомных 
ДНК маркеров для описания структуры 
генофонда популяций человека / Н.А.
Рудых, 
Евдокимов // Научн. ведомости 
Белгородского гос. ун-та. Серия: Медицина. 
Фармация.
– 2013.
– Т.
22, №
11.
– С.
Голимбет, В.Е. Молекулярно-генети-
ческие исследования познавательных нару-
шений при шизофрении / В.Е.
Голимбет // 
Молекулярная биология.
– 2008. Т.
– №
Ассоциация генов COMT и DRD2 
со способностью больных шизофренией к 
пониманию психического состояния других 
людей / М.В.
Алфимова [и
др.] // журн. 
неврологии и психиатрии.
– 2013.
– №8.
73.
Look beyond Catechol-O-Methyltransferase 
genotype for cathecolamines derangement in mi
graine: the BioBIM rs4818 and rs4680 polymor
phisms study / M.L.
De
Marchis [et
al.] // J.
Head
ache Pain.
– 2015.
– Vol.
16, №
520.
– P.
1–8.
Common oxytocin receptor gene (OXTR) 
polymorphism and social support interact to re
duce stress in humans / F.S.
Chen [et
al.] // Proc. 
Natl. Acad. Sci. U. S. A.
– 2011.
– Vol.
– P.
Witte, A.V. Effects of COMT polymor
phisms on brain function and behavior in health 
and disease / A.V.
Witte, A.
Floel // Brain Res. 
– Vol.
– P.
Association study of a brainаderived neu
rotrophic factor (BDNF) Val58Met polymor
phism and personality trait and intelligence 
in healthy young females / S.J.
Tsai [et
al.] // 
Neuropsychobiology.
– 2004. – Vol.
49, №
P.
Reuter, M. Association of the functional 
catechol-O-methyltransferase Val158Met poly
morphism with the personality trait of extraver
sion / M.
Reuter, J.
Hennig // Neuroreport.
– Vol.
– P.
1135–1138.
78.
Prefrontal neurons and the genetics of 
schizophrenia / D.R.
Weinberger [et
al.] // Biol. 
Psychiatry.
– 2001.
– Vol.
50, №
11.
– P.
825–844.
Халилова, З.Л. Влияние нейромеди-
аторных систем на развитие суицидального 
поведения / З.Л.
Халилова, Ф.Х.
Бикташева 
// Современная наука: теоретический и 
практический взгляд: материалы Третьей 
междунар. науч.-практ. конф. / Башкирский 
гос. ун-т; ред. Б.Е.
Аверин [и
– Уфа, 
Attention de�cit hyperactivity disorder: 
genetic association study in a cohort of Spanish 
children / C.I.
Gomez-Sanchez [et
al.] // Behav. 
– Vol.
– P.
Молекулярная и прикладная генетика. Том 20, 2016
г.
Л.В. Кухтинская и др. 
Современные представления о генетических детерминантах психоэмоциональной...
Norepinephrine transporter and catechol
amine-O-methyltransferase gene variants and at
tention-de�cit/hyperactivity disorder symptoms 
in adults / W.
Retz [et
al.] // J.
Neural. Transm.
– Vol.
115, №
– P.
82.
Madras, B.K. The dopamine transporter and 
attention-de�cit/hyperactivity disorder / B.K.
Ma
dras, G.M.
Miller, A.J.
Fischman // Biol. Psychia
try.
– 2005.
– Vol.
57, №
11.
– P.
1397–1409.
Novel and functional norepinephrine 
transporter protein variants identi�ed in atten
tion-de�cit hyperactivity disorder / M.K.
al.] // Neuropharmacology.
– 2009.
– Vol.
– P.
Differential internalization rates and 
postendocytic sorting of the norepinephrine and 
dopamine transporters are controlled by struc
tural elements in the N-termini / A.
Vuorenpaa 
– P.
85.
Experimental evidence of a link between 
the α2A-adrenergic receptor gene, early life stress, 
and ethanol drinking / E.
Comasco [et
al.] // Alco
hol Alcohol.
– 2015.
– Vol.
50, №
S1.
– P.
1–67.
Preliminary evidence for association be
tween schizophrenia and polymorphisms in the 
regulatory Regions of the ADRA2A, DRD3 and 
SNAP-25 Genes / J.
Lochman [et
al.] // Psychia
– Vol.
– P.
Clinical pharmacokinetics of metformin / 
Graham [et
al.] // Clin. Pharmacokinet.
2011.
– Vol.
– P.
Tamm, G. Perception of emotion in facial 
stimuli: The interaction of ADRA2A and COMT 
genotypes, and sex / G.
Tamm, K.
Harro // Prog. Neuropsychopharmacol. Biol. 
Psychiatry.
– Vol.
– P.
ADRA2A polymorphisms and ADHD in 
adults: possible mediating effect of personality 
/ C.C. de
Cerqueira [et
al.] // Psychiatry Res.
2011.
– Vol.
– P.
90.
No association between MspI allele of the 
ADRA2A polymorphism and ADHD: meta-analysis 
of family-based studies / N.D.
Shiffrin [et
al.] // Psy
chiatr. Genet.
– 2013.
– Vol.
23, №
4.
– P.
174–175.
OXT oxytocin/neurophysin I prepropep
tide (Homo sapiens (human)) [Electronic re
source] / National Center for Biotechnology 
– Bethesda M.D, USA.
– Mode of 
access: http://www.ncbi.nlm.nih.gov/gene?cm
92.
Oxytocin receptor genetic variation re
lates to empathy and stress reactivity in humans 
/ M.
Rodrigues [et
al.] // Proc. Natl. Acad. Sci. 
USA.
– 2009.
– Vol.
106, №
50.
– P.
21437–21441.
Feldman, R. The cross-generation trans
mission of oxytocin in humans / R.
Gordon, O.
Zagoory-Sharon. // Horm. Be
hav.
– Vol.
– P.
Poulin, M. J. The neurogenetics of nice 
receptor genes for oxytocin and vasopressin in
teract with threat to predict prosocial behavior 
/ M.J.
Poulin, E.A.
Holman, A.
Buffone // Psy
– Vol.
– P. 446–452.
Kumsta, R. Adolescent callous-unemo
tional traits and conduct disorder in adoptees ex
posed to severe early deprivation / R. Kumsta, E. 
Sonuga-Barke, M. Rutter // Br. J. Psychiatry.
– Vol.
– P.
Genetic variants in AVPR1A linked to 
autism predict amygdala activation and person
ality traits in healthy humans / A.
Meyer-Linden
berg [et
al.] // Mol. Psychiatry.
– 2009.
– Vol.
– P.
The role of oxytocin in social bonding, 
stress regulation and mental health: An update 
on the moderating effects of context and interin
dividual differences / M. Olff [et
al.] // Psycho
neuroendocrinology.
– 2013.
– Vol.
38, №
P.
98.
Cuartas Arias, J.M. Potential interactions 
between oxytocin receptor system (OXTR) and can
didate genes associated to psychopathy / J.M.
Cuar
tas Arias, C.A.
Lopez Jaramillo // Int. J.
Psychol. 
Res.
– 2013.
– Vol.
6, №
SPE.
– P.
109–116.
99.
Oxytocin receptor (OXTR) does not play 
a major role in the aetiology of autism: genetic 
and molecular studies / K.E.
Tansey [et
al.] // Neu
rosci. Lett.
– 2010.
– Vol.
474, №
3.
– P.
163–167.
Polymorphisms in the oxytocin receptor 
gene are associated with the development of psy
chopathy / M.R.
Dadds [et
al.] // Dev. Psycho
– Vol.
– P.
Oxytocin receptor gene (OXTR) is re
lated to psychological resources / S.
Bernstein [et
al.] // Proc. Natl. Acad. Sci. USA.
2011.
– Vol.
– P.
118–15
Oxytocin selectively increases percep
tions of harm for victims but not the desire to 
punish offenders of criminal offenses / F.
al.] // Soc. Cogn. Affect. Neurosci.
– 2013.
Vol.
– P.
Молекулярная и прикладная генетика. Том 20, 2016 г.
Л.В. Кухтинская и др. 
Современные представления о генетических детерминантах психоэмоциональной...
Culture, distress, and oxytocin recep
tor polymorphism (OXTR) interact to in�uence 
emotional support seeking / H.S.
Kim [et
al.] // 
Proc. Natl. Acad. Sci. USA.
– 2010.
– Vol.
– P.
AVP Gene (Protein Coding)
– Arginine 
Vasopressin. [Electronic resource] / The Gen
eCards human gene database.
– Weizmann In
stitute of Science, Rehovot, Israel.
– Mode of 
access: http://www.genecards.org/cgi-bin/card
disp.pl?gene AVP&keywords avp.
– Date of 
Copeptin as a stress marker prior and af
ter a written examination
– the CoEXAM study / 
S.A. Urwyler [et
al.] // Stress.
– 2015.
– Vol.
– P. 134–137.
Vasopressin: behavioral roles of an 
“original” neuropeptide / H.K.
Caldwell [et
// Prog. Neurobiol.
– 2008.
– Vol.
84, №
P.
Heterogeneity in clinical manifestation 
of autosomal dominant of neurohypophyseal di
abetes insipidus caused by a mutation encoding 
Ala-1-> Val in the signal peptide of the arginine 
vasopressin/neurophysin II/copeptin precursor 
/ D.R.
Repaske [et
al.] // J.
Clin. Endocrinol. 
– Vol.
– P.
Katan, M. The stress hormone copeptin: 
a new prognostic biomarker in acute illness / M. 
Katan, M. Christ-Crain // Swiss Med. Wkly.
– Vol.
Goodson, J.L. Social behavior functions 
and related anatomical characteristics of vaso
tocin/vasopressin systems in vertebrates / J.L. 
Goodson, A.H.
Bass // Brain Res. Brain Res. 
Rev. –2001.
– Vol.
– P.
110.
Fox, C. Therapeutic and protective effect 
of environmental enrichment against psycho
genic and neurogenic stress / C.
Fox, Z.
li, C.
Harrison // Behav. Brain Res.
– 2006.
Vol.
– P.
111.
Reduced plasma apelin levels in patients 
with autistic spectrum disorder / M.
Boso [et
// Arch. Med. Res.
– 2007.
– Vol.
– P.
112.
Association between the arginine vaso
pressin 1a receptor (AVPR1a) gene and autism 
in a family-based study: mediation by socializa
tion skills / N.
Yirmiya [et
al.] // Mol. Psychia
try.
– Vol.
11, №
– P.
113.
Hopkins, W.D. A polymorphic indel con
taining the RS3 microsatellite in the 5′ �anking 
region of the vasopressin V1a receptor gene is 
associated with chimpanzee (Pan troglodytes) 
personality / W.D.
Hopkins, Z.R.
Young // Genes Brain Behav.
– 2012.
Vol.
11, №
– P.
114.
Genetic variation in the vasopressin re
ceptor 1a gene (AVPR1A) associates with pair-
bonding behavior in humans / H.
Walum [et
// Proc. Natl. Acad. Sci. USA.
– 2008.
– Vol.
– P.
115.
Zink, C.F. Human neuroimaging of 
oxytocin and vasopressin in social cognition / 
C.F.
Zink, A.
Meyer-Lindenberg // Horm. Be
hav.
– Vol.
– P.
116.
AVPR1B Gene (Protein Coding)
– Ar
ginine Vasopressin Receptor 1B [Electronic 
resource] / The GeneCards human gene data
– Weizmann Institute of Science, Rehovot, 
– Mode of access: http://www.genecards.
org/cgi-bin/carddisp.pl?gene AVPR1B.
– Date 
117.
A complex selection signature at the hu
man AVPR1B gene / R.
Cagliani [et
al.] //BMC 
EVol.
– Vol.
– P.
118.
Possible genetic association between 
vasopressin receptor 1B and child aggression 
/ C.C.
Zai [et
al.] // Psychiatry Res.
– 2012.
Vol.
– P.
119.
Family-based study of AVPR1B associ
ation and interaction with stressful life events 
on depression and anxiety in suicide attempts 
/ Y.J.
Ben-Efraim [et
al.] // Neuropsychophar
macology.
– 2013.
– Vol.
38, №
8.
– P.
1504–
1511.
Parker, G.B. From diathesis to dimor
phism: the biology of gender differences in de
pression / G.B.
Parker, H.L.
Brotchie // J. Nerv. 
Ment. Dis.
– 2004.
– Vol.
192, №
– P.
Эстрогены и головной мозг / 
Карева [и
др.] // Вестн. Российской акад. 
мед. наук.
Молекулярная и прикладная генетика. Том 20, 2016
г.
Л.В. Кухтинская и др. 
Современные представления о генетических детерминантах психоэмоциональной...
.V. Kukhtsinskaya, 
.V. Zuraev, V.
NAL 
USTA
Institute of Genetics and Cytology of the National Academy of Sciences of Belarus
Minsk BY-220072, Republic of Belarus
This review article highlights current research state in �eld of stress resistance genetics. Mechanisms of emotional 
stress based on functioning of the transporter and receptor systems, such as serotonin, dopamine, noradrenaline, oxytocin 
and vasopressin systems are discussed. The interaction of genes, which are associated with human psychoemotional 
peculiarities and the in�uence of environmental factors on different steps of ontogenesis are responsible for individual 
differences of human psychic stress resistance.
Key words: 
psychic stress resistance, genetic mechanisms, serotonin system, noradre-naline system, oxytocin system.
Дата поступления статьи 11 февраля 2016 г.
Молекулярная и прикладная генетика. Том 20, 2016
г.
ПРАВИЛА ОФОРМЛЕНИЯ СТАТЬИ
Статьи должны быть написаны в сжатой и ясной форме и содержать:
• соответствующий индекс универсальной десятичной классификации литературы (УДК);
• название на русском и английском языках;
• инициалы и фамилии авторов на русском и английском языках;
• полное название учреждений, в которых выполнялось исследование и их почтовые 
адреса;
• ключевые слова (3…5 слов);
• аннотацию на русском и английском языках. Аннотация должна ясно излагать содер
жание статьи и быть пригодной для опубликования в аннотациях к журналам отдельно 
от статьи;
• текст статьи (стандартизировать, используя подзаголовки «Введение», «Материалы 
методы», «Результаты и обсуждение», «Заключение»);
• список использованных источников (оформляется в соответствии с Правилами ВАК, 
Приложение 2);
• дату поступления статьи в редакцию.
Объем статьи должен составлять не менее 14 000 знаков, включая пробелы, до 10–12 стра
ниц. Рекомендуемый средний объем аннотации – 500 знаков с пробелами. После распечатки 
статья должна быть вычитана автором (авторами). На последней ее странице должна(ы) быть 
подпись(и) автора(ов). Текст статьи идентичного содержания представляется в электронном 
виде (по e-mail или на дискете) и на бумажном носителе в 2 экз. В
виде отдельного документа 
представляются краткие сведения о каждом из авторов, включающие фамилию, имя, отчество, 
год рождения, сведения об образовании, служебные адреса, адрес электронной почты, ученую 
степень, ученое звание, должность, область научных интересов. Необходимо представить АКТ 
ЭКСПЕРТИЗЫ о возможности опубликования открытой печати (для статей).
1. Сдаваемый документ должен быть представлен в электронном виде в формате MS-
Word. Название файлов
– фамилия первого автора латинскими буквами.
2. Формат бумаги А4 (210×297 мм), ориентация – книжная.
3. Поля: верхнее
– 2,5 см, нижнее – 2,5 см, левое
– 2,5 см, правое – 2,5 см.
4. Основной текст статьи набирается шрифтом Times New Roman, размером 12 пт, в 
одну колонку с одинарным межстрочным интервалом. Не допускается использование та
буляции или пробелов для обозначения первой строки абзаца. 
5. Автоматическая расстановка переносов обязательна. 
6. Название статьи набирать полужирным начертанием шрифта по центру. Переносы в 
заголовках не допускаются. 
7. Все таблицы, содержащиеся в документе, должны быть реализованы средствами ра
боты с таблицами редактора MS-Word. Не допускается вложение таблиц, созданных в 
других программах. Таблицы и графики должны быть пронумерованы и иметь названия. 
Не допускается размещение таблиц и рисунков в конце статьи (непосредственно перед 
списком литературы). 
Молекулярная и прикладная генетика. Том 20, 2016
г.
8. Вставка в текст символов (например, β, €) производится только через опцию «Встав
ка\Символ». Выключку вверх и вниз (С
, С
) выполнять через меню «Формат\Шрифт\
Верхний индекс\Нижний индекс». Греческие символы должны быть прямыми, латинские 
буквы набираются 
курсивом
. Математические формулы (lim, sum, sin, и
т.д.) и цифры на
бираются прямым начертанием. 
9. Печатать в сложных словах дефис (минерал-индикатор, К-пространство). Тире отбивают 
с обеих сторон неразрывным пробелом как знак препинания между словами: система «чело
век
машина», «май
— июнь». Тире между цифрами, напр., 20–30 чел. — не отбивается.
10. Кавычки по всему тексту должны быть одного «рисунка». Кавычки не отбивают от 
заключенных в них слов.
11. При подготовке к печати графиков, блок-схем, диаграмм, файлы должны быть пои
менованы таким образом, чтобы было понятно, к какой статье они принадлежат и какими 
по порядку рисунками статьи являются. Графики должны иметь толщину всех линий не 
менее 0,2 пункта для четкого воспроизведения. Все надписи на рисунках должны быть 
набраны на компьютере и сгруппированы с рисунком, не допускается использование ска
нированного текста. 
12. Необходимо предоставить электронные файлы фотоматериалов, а также распечатки 
лазерным принтером всех иллюстраций на листе формата А4. Отсканированные фото
иллюстрации серой, черно-белой цветовой модели должны иметь разрешение 600 dpi и 
формат TIFF. 
13. Список цитированных источников располагается в конце текста, ссылки нумеруются со
гласно порядку цитирования в тексте. Порядковые номера ссылок д.б. написаны внутри ква
дратных скобок. (напр.: [1]).
Научное издание
МОЛЕКУЛЯРНАЯ И ПРИКЛАДНАЯ ГЕНЕТИКА
СБОРНИК НАУЧНЫХ ТРУДОВ
Том 20
Ответственный за выпуск 
И.В. Широкая
Верстка 
Е.А. Клевец
Корректор
 И.В. Широкая
Технический редактор 
Е.А. Клевец
Переводчик 
А.А. Абметко
Подписано в печать 16.03.2016. Формат 60×84 
. Бумага офсетная. Гарнитура Times.
Печать цифровая. Усл. печ. л. 13,02. Уч.изд. л. 8,38. Тираж 100 экз. Заказ № 99
Отпечатано в типографии ЧУП «Альтиора».
Оригинал-макет подготовлен в Государственном научном учреждении «Инcтитут генетики 
и цитологии НАН Беларуси»
Свидетельство о государственной регистрации издателя, изготовителя,
распространителя печатных изданий №
1/51 от 08.10.2013 г.  
220072, г. Минск, ул. Академическая, 27

Приложенные файлы

  • pdf 44541212
    Размер файла: 5 MB Загрузок: 0

Добавить комментарий